The largest database of trusted experimental protocols

12 protocols using chi3l1

1

Measurement of Fibrosis Biomarkers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Levels of fibrosis biomarkers were measured on EDTA plasma by ELISA or multiplex assay using commercially available kits. HA (Echelon Biosciences, Salt Lake City, UT), LOXL2 (R&D Systems, Minneapolis, Minnesota), and CICP and CIC C1Q (Quidel, San Diego, CA) were measured by ELISA. PAI-1, PCSK9, TGF-β1-3, MMP-2, MMP-9, TIMP-1, CXCL4, Chi3L1 (all R&D Systems, Minneapolis, MN) were measured using Luminex xMAP technology. All analytes except LOXL2 were measured according to the manufacturers’ instructions. For LOXL2, the ELISA plates were coated overnight with capture antibody at room temperature. The plate was blocked with reagent diluent 1 (R&D Systems, Minneapolis, MN) for 1 hour and washed. Plasma was diluted 1:10 in PBS-Tween 10 and added to the plate. After incubating for 2 hours at 37° C and washing, detection antibody was added for 2 hours at 37° C. The plate was washed, streptavidin was added and the plate was incubated for 20 minutes at room temperature. After washing, TMB was added (Sigma-Aldrich Corp., St. Louis, MO), the plate was incubated for 20 minutes at room temperature, and sulfuric acid was added to stop the reaction. The plate was read at 450 nm.
+ Open protocol
+ Expand
2

Quantifying Key Proteins in Proteomics

Check if the same lab product or an alternative is used in the 5 most similar protocols
The key proteins, where clear differences were found during the proteome profiler measurements, were quantified using custom Human Magnetic Luminex Assay (CHI3L1, C5a, EGF, CD40L, VEGF, CRP, Il-17a, Osteopontin, Angiopoetin, IL-1RA, EMMPRIN, Lipocalin-2, Pentraxin-3, PDGF-AA, PDGF-BB) (R&D Systems Inc.) or ELISA assays (MPO, ALCAM, CD97, C1qR1, TGF-beta, Fibrinogen, Thrombospondin-1, CXCL-5) (Abcam, Cambridge, UK) (n = 8)
+ Open protocol
+ Expand
3

ApoE Secretion and Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
ApoE secreted into the medium was measured by ELISA and confirmed by Western Blot analysis as described previously [23] (link). Secretion and cellular levels of apoE and other macrophage proteins were determined by Western blotting with the following antibodies: apoE (Meridian lifesciences), fibronectin (BD biosciences), matrix metalloproteinase 9 (MMP9; abcam) clathrin heavy chain (CHC; BD biosciences), heat shock protein 90 (HSP90; BD biosciences), chitinase-3-like protein 1 (CHI3L1; R & D systems), cyclophilin A (CypA; Abcam) dynamin I (Abcam) and dynamin II (Abcam).
Total RNA was isolated, and apoE mRNA levels were analyzed by quantitative real time-PCR as described previously [23] (link).
+ Open protocol
+ Expand
4

Serum Biomarker Quantification by ELISA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Serum biomarker levels were determined using a double-antibody sandwich ELISA according to the manufacturer's instructions (CHI3L1, R&D systems, USA; MMP13, CUSABIO, China; SPP1, ebioscience, USA). They were analyzed blinded to clinical parameters and study endpoints at the end of the study.
Briefly, 100 μl of the test samples (1:100 diluted for CHI3L1, original for MMP13, 1:5 diluted for SPP1) were added and incubated for 2 h at room temperature. Subsequently, 100 μl/well of the detection antibody was added and incubated for 2 h at room temperature. Next, 100 μl/well of Streptavidin-HRP was added and incubated for 20 min at room temperature. Finally, the substrate (tetramethylbenzidine) solution was added, and the reaction was stopped with 2 N H2SO4 and read at an OD of 450 nm. For Intra-assay Precision: CHI3L1, CV: 5.2% (0.25 ng/ml) and CV: 3.6% (2 ng/ml); MMP13, 4.9% (2 ng/ml) and 2.3% (10 ng/ml); SPP1, 4.1% (2 ng/ml) and 2.9% (10 ng/ml). For Inter-assay Precision: CHI3L1, 10.1% and 7.5%; MMP13, 8.7% and 6.1%; SPP1, 6.6% and 5.6%, respectively.
+ Open protocol
+ Expand
5

Quantifying Fibrosis Biomarkers in Plasma

Check if the same lab product or an alternative is used in the 5 most similar protocols
Levels of fibrosis biomarkers were measured on EDTA plasma by ELISA or multiplex assay using commercially available kits. HA (Echelon Biosciences, Salt Lake City, UT), LOXL2 (R&D Systems, Minneapolis, Minnesota), and CICP and CIC C1Q (Quidel, San Diego, CA) were measured by ELISA. PAI-1, PCSK9, TGF-ß1-3, MMP-2, MMP-9, TIMP-1, CXCL4, Chi3L1 (all R&D Systems, Minneapolis, MN) were measured using Luminex xMAP technology. All analytes except LOXL2 were measured according to the manufacturers' instructions. For LOXL2, the ELISA plates were coated overnight with capture antibody at room temperature. The plate was blocked with reagent diluent 1 (R&D Systems, Minneapolis, MN) for 1 hour and washed. Plasma was diluted 1:10 in PBS-Tween 10 and added to the plate. After incubating for 2 hours at 37° C and washing, detection antibody was added for 2 hours at 37° C. The plate was washed, streptavidin was added and the plate was incubated for 20 minutes at room temperature. After washing, TMB was added (Sigma-Aldrich Corp., St. Louis, MO), the plate was incubated for 20 minutes at room temperature, and sulfuric acid was added to stop the reaction. The plate was read at 450 nm.
+ Open protocol
+ Expand
6

Perioperative Blood Biomarker Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
All enrolled patients had blood samples taken 1 day before and 1 day after surgery. The blood analysis including hemoglobin, white blood cells, serum creatinine, alanine aminotransfease (ALT), aspartate aminotransferase (AST), albumin, interleukin-6 (IL-6), IL-1β, CHI3L1, and C-reactive protein (CRP) was measured. All indicators except IL-6, IL-1β, and CHI3L1 were detected using standard laboratory techniques which are already part of the clinical routine in our hospital. The obtained blood samples were centrifugation for 15 min at 1000×g after being clotted for 30 min at room temperature. Then serum samples were separated and stored at −80 °C for further laboratory tests. The levels of serum factors were examined using enzyme-linked immunosorbent assay kits in accordance with the instructions of the manufacturer's procedure: IL-1β (proteintech, Wuhan, China), IL-6 (proteintech, Wuhan, China), and CHI3L1 (R&D Systems, Minneapolis, MN, USA). The obtained serum samples were diluted 50-fold (baseline) or 750-fold (1 day after surgery) before CHI3L1 detection. Repeated measurements were performed and finally averaged by comparing their absorbance with the standard curve. The postoperative day 1-time point was based on the results of the preliminary experiment suggesting that CHI3L1 rises substantially from baseline to postoperative day 1 compared with other time points.
+ Open protocol
+ Expand
7

Stem Cell Marker Immunofluorescence and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were cultured on coverslips and fixed with 4% paraformaldehyde. Cell permeabilization was achieved using 0.1%Triton X-100 incubation for 20 minutes and blocking with 1% BSA for one hour. Cells were treated overnight at 4°C with primary antibodies for OCT4-FITC (SantaCruz Bioscience), alkaline phosphatase-PE, SSEA4-APC (eBioscience), SSEA1-PerCP (Biolegend), HNK1-PECY7 (Invitrogen), NGFR-APC (BD Pharmingen), CHI3L1 (R&D Systems), and myocilin (SantaCruz). Phalloindin-555 was used to stain F-actin and DAPI was employed as a nuclear stain and samples were acquired using laser scanning confocal microscope (Olympus).
Real-time PCR:
RLT buffer was used for lysis of cultured cells and an RNA purification kit (RNeasy Mini Kit, Qiagen) was used for isolation of total RNAs. RNAs were reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). SYBR green (Applied Biosystems) chemistry was used for qPCR. Primer3 was used to design primers for Housekeeping gene 18S rRNA (Forward: CCCTGTAATTGGAATGAGTCCAC, Reverse: GCTGGAATTACCGCGGCT), myocilin (forward: AAGCCCACCTACCCCTACAC; reverse: TCCAGTGGCCTAGGCAGTAT), CHI3L1 (forward: CCTTGACCGCTTCCTCTGTA; reverse: GTGTTGAGCATGCCGTAGAG), ANGPTL7 (forward: GCACCAAGGACAAGGACAAT; reverse: GATGCCATCCAGGTGCTTAT).
+ Open protocol
+ Expand
8

Molecular Signaling Regulation by Chi3l1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant mouse proteins (Chi3l1, rIL13Rα2, RANKL, and M-CSF) were provided by R&D systems (USA). The Gibco BRL (USA) provided minimal essential medium alpha (α-MEM), fetal bovine serum (FBS), 0.25% EDTA-trypsin, and penicillin-streptomycin. RiboFECTTM transfection reagent, Chi3l1-siRNA, and IL13Rα2-siRNA came from RiboBio company (China). Primary antibodies targeting p-Akt (Ser473), Akt, p-ERK, ERK, p-JNK, JNK, p-P38, P38, p-P65, P65, and GAPDH were obtained from Cell Signaling Technology (CST, USA). The Abcam (USA) provided the primary antibody recognizing Chi3l1, which was used for immunofluorescence (IF) and western blot (WB). The primary antibody that recognized Chi3l1 used for co-immunoprecipitation (IP) and IL13Rα2 for IF and WB came from R&D systems (USA). Santa Cruz (USA) offered the primary antibody that recognized IL13Rα2 for IP.
+ Open protocol
+ Expand
9

Quantification of Trabecular Meshwork Cellularity

Check if the same lab product or an alternative is used in the 5 most similar protocols
The mouse eyes were fixed in 4% paraformaldehyde overnight and embedded in paraffin. After dewaxing, rehydration, heat-induced epitope retrieval and blocking with 10% heat-inactivated goat serum, sections were incubated with primary antibodies to myocilin, CHI3L1 (R and D Systems), collagen IV, Ki67(Abcam), AQP1(Santa Cruz) overnight at 4°C. After three washes with PBS, corresponding fluorescent secondary antibodies and 4′,6-diamidino-2-phenylindole (DAPI) were applied to the sections for 1 hr. After five washes, slides were mounted and imaged using a confocal microscope (Olympus IX81) and analyzed on FV10-ASW4.2 Viewer (Olympus). For measuring TM cellularity, primary antibody against collagen IV, together with phase-contrast images, were used to define the TM region in the sections. Cell nuclei stained with DAPI within the TM region were counted under FV10-ASW4.2 Viewer. Images of at least 10 fields per group were photographed, and the number of cell nuclei per field was counted and averaged.
+ Open protocol
+ Expand
10

Plasma Protein Measurement Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
In the Bruneck year 2000 evaluation and the SAPHIR study, the following proteins were measured by ELISA in plasma samples according to the manufacturers’ instructions: MMP9 from R&D Systems (DMP900); CHI3L1 from R&D Systems (DC3L10); LGALS3BP from R&D Systems (DGBP30); S100A8/A9 from BMA Biomedicals. Additional plasma proteins were analyzed using proximity extension assays (CVD I and Inflammation I panels, Olink) as previously published (15 (link)).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!