Soil samples from different regions of China were collected and 10-fold serially diluted in glass tubes. 0.1 mL dilutions was spread on Man Ragosa Sharpe (MRS) agar plates and anaerobic cultured on DG250 Anaerobic workstation (DWS, United Kingdom) at 37°C for 24 h. Single colonies appeared on MRS agar plates were purified twice and stored in 25% (v/v) glycerol at -80°C. The P. pentosaceus SL001 was grown on MRS liquid medium at 37°C for 12 h under anaerobic condition, and then scanning electron microscopy (SEM, Hitachi Su8010, Japan) were used to observe the morphology of the bacterial cell. Biochemical characterization of SL001 was done subsequently. Genomic DNA was extracted from a SL001 using a genomic DNA extraction kit according to the manufacturer’s instructions (Sangon, China). The DNA fragments carrying 16S rRNA gene were amplified using primer pair 27F (5′ to 3′: AGAGTTTGATCCTGGCTCAG) and 1492R (5′ to 3′: CGGTTACCTTGTTACGACTT) (Wu et al., 2010 (link); Yi et al., 2018 (link)). The polymerase chain reaction (PCR) products were purified and cloned into pMD18-T vector (TaKaRa, Japan). Single colonies were picked up and sent for sequencing. Phylogenetic tree was constructed on the basis of 16S rRNA genes by the neighbor-joining method using MEGA6.06 software and evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura et al., 2004 (link)).
Genomic dna extraction kit
Manufactured by Sangon
Sourced in China
The Genomic DNA Extraction Kit is a laboratory tool designed to extract and purify genomic DNA from a variety of biological samples. It provides a simple and efficient method for obtaining high-quality genomic DNA for downstream applications such as PCR, sequencing, and genetic analysis.
Automatically generated - may contain errors
Lab products found in correlation
Lysostaphin, by Sangon (3 mentions)
Miseq platform, by Illumina (2 mentions)
Pmd18 t vector, by Takara Bio (1 mentions)
Su8010, by Hitachi (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)
Methylcode bisulfite conversion kit, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Hotstartaq, by Qiagen (1 mentions)
Hotstar taq polymerase, by Qiagen (1 mentions)
Taq dna polymerase, by Takara Bio (1 mentions)
Truseq nano dna ht sample preparation kit, by Illumina (1 mentions)
Hiseq x ten platform, by Illumina (1 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (1 mentions)
Nanophotometer spectrophotometer, by Implen (1 mentions)
25 protocols using genomic dna extraction kit
1
Isolation and Characterization of Pediococcus pentosaceus SL001
2
Sequencing Moth mt Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The moths of A. rubiginosa and R. menciana were collected in Xuancheng, Anhui Province. Total DNA was isolated using the Genomic DNA Extraction Kit (SangonBiotech, China) according to manufacturer instructions. Extracted DNA was used to amplify the complete mt genomes by PCR.
3
Rapid DNA Extraction from S. aureus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S. aureus isolates tested were cultured on blood agar overnight. Three to four bacterial colonies were suspended in 150 μL sterile distilled water with 10 μL lysostaphin (1 mg/mL) (Sangon, China) and incubated at 37 °C for 30 min. DNA was extracted using the Genomic DNA Extraction kit in accordance with the manufacturer's instructions (Sangon, China). The extracted DNA was stored at −20 °C and prepared for PCR amplification.
4
Genomic DNA Extraction Quality Verification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sample DNA was extracted strictly according to the instructions of genomic DNA extraction kit (Sangon Bioengineering Co., Ltd, Shanghai) and the extracted DNA was stored at −20°C. DNA quality detection: ➀ Five microliter of DNA solution was loaded to a 1% agarose gel and the gel was run in 1xTAE at 120 V. A single clear band indicates the extracted DNA to be intact and of sufficient concentration for a PCR reaction. ➁ The concentration and purity were detected by spectrophotometer, and 1 μL DNA solution was loaded to Nanodrop to determine the OD values. A value of OD260/280 between 1.7 and 2.0 demonstrates a reliable quality of the extracted DNA.
5
Extraction of Genomic DNA from Staphylococcus aureus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S. aureus isolates with FA resistance were cultured on blood agar overnight at 35 °C. Then, three to four bacterial colonies were suspended in 150 μl sterile distilled water with lysostaphin (1 mg/mL) (Sangon, Shanghai, China) and incubated at 37 °C for an hour. Finally, DNA was extracted following the instructions of the Genomic DNA Extraction kit (Sangon, Shanghai, China), stored at −20 °C and prepared for PCR assays.
6
Mitogenome assembly and annotation of moths
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total genomic DNA was extracted from muscle using the Genomic DNA Extraction Kit (Sangon Biotech, Shanghai, China), and the quality of total DNA was checked with 1% agarose gels. Extracted DNA was sequenced using the next-generation sequencing technology. The whole-genome shotgun method was used to get paired-end libraries and sequence on an Illumina MiSeq platform (Novogene, Beijing, China), with the target insert size of 500 bp.
The assembly and annotation of mitogenome data were done by Mitoz v.2.3 [22 (link)]. Firstly, the raw fastq files were filtered by the filter module in Mitoz v.2.3 [22 (link)] to obtain clean data. Then, based on the obtained clean data, the assembly and annotation module in Mitoz v.2.3 [22 (link)] was employed for assembly and annotation of the complete mitogenomes with genetic code 5 and clade Arthropoda and other parameters as default. Finally, gene boundaries were further confirmed and aligned against the published mitogenome sequences of moths using MEGA v.7.0 [23 (link)].
The complete mitogenomes of 17 moth species were submitted to GenBank, and the accession numbers in bold beginning with OP are shown inTable 1 .
The assembly and annotation of mitogenome data were done by Mitoz v.2.3 [22 (link)]. Firstly, the raw fastq files were filtered by the filter module in Mitoz v.2.3 [22 (link)] to obtain clean data. Then, based on the obtained clean data, the assembly and annotation module in Mitoz v.2.3 [22 (link)] was employed for assembly and annotation of the complete mitogenomes with genetic code 5 and clade Arthropoda and other parameters as default. Finally, gene boundaries were further confirmed and aligned against the published mitogenome sequences of moths using MEGA v.7.0 [23 (link)].
The complete mitogenomes of 17 moth species were submitted to GenBank, and the accession numbers in bold beginning with OP are shown in
7
Mitochondrial Genome Sequencing of Dybowski's Grasshopper
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The specimens of D. dybowskyi were collected in Huoshankou Forest Park (44.08° N, 128.73° E), Ning’an County, Heilongjiang Province, China, on 10 August 2015. The genomic DNA was extracted from the thoracic muscle of a single specimen using the Genomic DNA Extraction Kit (Sangon Biotech, Shanghai, China), following instruction of the manufacturer.
The mitochondrial genome of D. dybowskyi was sequenced using the next-generation sequencing technology. By the whole-genome shotgun method, paired-end libraries were constructed and sequenced on an Illumina MiSeq platform at the Personal Biotechnology Company (Shanghai, China). The target insert size was 500 bp. The adapter sequences were removed and low-quality bases were trimmed using the Trimmomatic version 0.36 (Bolger et al. 2014 (link)). These targeted sequences were assembled using the A5-miseq v2015022 (Coil et al. 2015 (link)) and Spades v3.9.0 (Bankevich et al. 2012 (link)) software.
The mitochondrial genome of D. dybowskyi was sequenced using the next-generation sequencing technology. By the whole-genome shotgun method, paired-end libraries were constructed and sequenced on an Illumina MiSeq platform at the Personal Biotechnology Company (Shanghai, China). The target insert size was 500 bp. The adapter sequences were removed and low-quality bases were trimmed using the Trimmomatic version 0.36 (Bolger et al. 2014 (link)). These targeted sequences were assembled using the A5-miseq v2015022 (Coil et al. 2015 (link)) and Spades v3.9.0 (Bankevich et al. 2012 (link)) software.
8
Genomic DNA and RNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of cells was independently extracted by Genomic DNA Extraction Kit according to the manufacturer’s instructions (Sangon, Shang Hai, China). Total RNAs of BmN cell and multi silkworm strain were extracted using TRIzol reagent (Invitrogen, Waltham, USA) according to the manufacturer’s instructions, then precipitated and purified with isopropyl alcohol and dissolved in DEPC water. The assessing optical density (OD) absorbance ratio of 260/280 was determined. The concentration of RNA was detected using a NanoDrop 2000 spectrophotometer. RNA integrity was checked by 1% agarose gel electrophoresis. A total of 1.0 µg of RNA was reverse-transcribed in vitro by the PrimeScriptTM RT reagent kit according to the manufacturer’s instructions.
9
Idiopathic Epilepsy mtDNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We recruited 200 idiopathic epilepsy patients from the Epilepsy Translational Medicine Project of Linyi People’s Hospital, Shandong, China. Phenotypic and diagnostic classification of epilepsy syndromes in the project were carried out according to 2014 ILAE Classification and Diagnostic Criteria (Fisher et al. 2014 (link)) and were reviewed by experienced epileptologists. Fifteen patients（one idiopathic partial epilepsy patient and 14 idiopathic generalized epilepsy patients）were selected for complete mtDNA sequencing. In our study, idiopathic epilepsy patients were selected as the following criteria: no any definite cause (brain trauma, stroke, tumour, intracranial infection, autoimmune diseases and so on); no lesions were found in MRI; no cognitive impairment; no other diseases (especially mitochondrial diseases); no genetic relationship with included patients. 200 healthy controls were selected from the Medical examination center of our hospital and 12 were randomly selected for complete mtDNA sequencing. This study was approved by the local Institutional Review Board and all study participants gave informed consent.
Blood sample were obtained from these patients and stored at −80 °C. Total DNA was extracted using the Genomic DNA Extraction Kit (Sangon Biotech, Shanghai, China) and stored at −20 °C prior to use.
Blood sample were obtained from these patients and stored at −80 °C. Total DNA was extracted using the Genomic DNA Extraction Kit (Sangon Biotech, Shanghai, China) and stored at −20 °C prior to use.
10
Plasmid Extraction and DNA Manipulation in P. aeruginosa and E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small-scale plasmids were prepared from P. aeruginosa derivatives or E. coli using the alkaline lysis method or Plasmid DNA Extraction Kit (Sangon, Shanghai, China). Chromosomal DNA was isolated from P. aeruginosa with the method as described by Chen and Kuo [37 (link)] or by using the Genomic DNA Extraction Kit (Sangon, Shanghai, China). Standard DNA recombinant techniques were applied for digestion, agarose gel electrophoresis, dephosphorylation, isolation of DNA fragments from agarose gels, and ligation. E. coli or Pseudomonas sp. cells were transformed with plasmid DNA by CaCl2 treatment or electroporation, respectively [38 (link)].
Polymerase chain reactions (PCRs) were typically performed with 2.5U of thermostable DNA polymerase in a reaction mixture containing 100 ng of target DNA. A 250 μM concentration of each of the four dNTPs, 10 pmol of two primers, 5 mM MgCl2, and 1×buffer in a final volume of 25 μl were used for the amplification reaction. A total of 30 or 33 cycles (2 min at 94°C, 30 sec at 50 to 55°C, and 1 min 72°C) was followed by a final elongation step for 7 min at 72°C. PCR products were cloned into pGEM-T or pBluescript II SK for verification by sequencing.
Polymerase chain reactions (PCRs) were typically performed with 2.5U of thermostable DNA polymerase in a reaction mixture containing 100 ng of target DNA. A 250 μM concentration of each of the four dNTPs, 10 pmol of two primers, 5 mM MgCl2, and 1×buffer in a final volume of 25 μl were used for the amplification reaction. A total of 30 or 33 cycles (2 min at 94°C, 30 sec at 50 to 55°C, and 1 min 72°C) was followed by a final elongation step for 7 min at 72°C. PCR products were cloned into pGEM-T or pBluescript II SK for verification by sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!