S cerevisiae invsc1

The candidate genes for ELO and DES were extracted from the Parietichytrium draft genome database by local BLAST using previously known ELO/DES genes as query sequences. The ORFs of the putative ELO (ELO-1, ELO-2, and ELO-3) and DES (DES-1, DES-2, DES-3, DES-4, DES-5, and DES-6) were amplified by PCR using cDNA or genomic DNA of Parietichytrium, and inserted into the MCS of pYES2/CT (Invitrogen). The ω3DES of S. diclina^{33 (link)} and M. alpina^{50 (link)} were obtained from genomic DNA and cDNA, respectively, by PCR, and inserted into pYES2/CT. The expression vectors were introduced into S. cerevisiae INVSc1 (Invitrogen) using the lithium acetate method^{51 (link)}. The transformants were selected by plating on synthetic agar plates lacking uracil (SC-ura). S. cerevisiae transformants harboring ELO and DES were cultured in SC-ura medium containing 2% glucose at 25 °C for 1 day, and then cultured for an additional 1 day in SC-ura medium containing 2% galactose and 50 μM fatty acids (substrate), as described in Supplementary Fig. S1a. The cells were collected by centrifugation at 2000 × g for 10 min and lyophilized. The fatty acid profiles were obtained by GC analysis. ELO or DES activity was expressed as follows: activity (%) = product area × 100/(substrate area + product area).

According to the gene sequence of GLP‐2 (NP‐999489), the complete GLP‐2 gene was synthesized by Invitrogen Co (Invitrogen, Shanghai, China). The plasmid pMD19‐GLP‐2 was linearized with KpnI and XhoI. Subsequently, the purified GLP‐2 insert was cloned into multiple cloning sites of the 5,962 bp expression vector pYES2/CT (Invitrogen, CA, USA). The recombinant construct was designated the plasmid of pYES2‐GLP‐2 that contained a yeast GAL1 promoter, a URA3 gene, a versatile multiple cloning site and an ampicillin resistance gene. Thereafter, the plasmid of pYES2‐GLP‐2 was transformed into S. cerevisiae (INVSc1) (Invitrogen, USA) using the chemical method. The transformant was designated GLP2‐SC and expressed the GLP‐2 protein. PCR identification of the GLP2‐SC strain was performed using the primer pair GLP2‐F (5′‐CGGGATCCAAAAAAATGCATGGTGATGGTTCT‐3′) and the reverse primers GLP2‐R (5′‐CCCTCGAGTTATTCAGTAACTTTAGT‐3′). The PCR programme was as follows: 94°C (5 min), followed by 30 cycles of 94°C (45 s), 60°C (30 s) and 72°C (30 s), with a final extension at 72°C (10 min). The original pYES2/CT plasmid (without the GLP‐2 DNA insert) was transformed into S. cerevisiae as a control, which was designated EV‐SC in the current research.