Log In Sign up
The largest database of trusted experimental protocols

Tamoxifen

Manufactured by MedChemExpress
Visit Supplier
Sourced in United States

Tamoxifen is a selective estrogen receptor modulator (SERM) used as a laboratory reagent. It functions by binding to and modulating the activity of estrogen receptors in cells.

Automatically generated - may contain errors

Lab products found in correlation

Fulvestrant, by MedChemExpress (2 mentions) Mcf 7, by MedChemExpress (2 mentions) Hek293t, by American Type Culture Collection (2 mentions) Foetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions) Azd9496, by MedChemExpress (1 mentions) β estradiol, by MedChemExpress (1 mentions) Azd7762, by Merck Group (1 mentions) Nu7441, by Selleck Chemicals (1 mentions) Progesterone, by MedChemExpress (1 mentions) Arachidonic acid, by Merck Group (1 mentions) Cisplatin, by MedChemExpress (1 mentions) Doxorubicin, by MedChemExpress (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Mda mb 231, by MedChemExpress (1 mentions) Penicillin streptomycin, by Beyotime (1 mentions) Mda mb 231, by American Type Culture Collection (1 mentions) Mcf 7, by American Type Culture Collection (1 mentions) Bt549, by American Type Culture Collection (1 mentions) Mda mb 468, by American Type Culture Collection (1 mentions) Hs578t, by American Type Culture Collection (1 mentions)

Close spelling variants of this product

Tamoxifen (HY-13757A, (2 citations)

15 protocols using tamoxifen

1

Doxorubicin-induced Cardiac Hypertrophy Model

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
All animal experimental procedures were carried out in compliance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals (8th Edition, 2011) and the study was authorized by the Fourth Military Medical University Ethics Committee. Dox (5 mg/kg/week, MedChem Express) was administered intraperitoneally to male C57BL/6 mice aged 8-10-weeks for consecutive 3 weeks [13 (link),14 (link)]. The total cumulative Dox dosage was 15 mg/kg. Age-matched C57BL/6 mice were given the same volume of saline vehicles as the control animals.
Cardiac-specific Mfn2 Transgenic mice (Tg-Mfn2) were generated by crossing Rosa26-CAG-Loxp-Stop-Loxp-Mfn2 knock-in mice with αMHC-Mer-Cre-Mer (tamoxifen-inducible heart-specific Cre) mice on C57BL/6 genetic background, both of which were obtained from Shanghai Model Organisms Center. A 5-day intraperitoneal tamoxifen (20 mg/kg/d, MedChem Express) injection was used to elicit gene recombination as described previously [15 (link)] in 10-week-old mice followed by an additional 2 weeks to allow the clearance of tamoxifen. Age-matched male littermates (Rosa26-CAG-Loxp-Stop-Loxp-Mfn2) treated with comparable tamoxifen were served as non-transgenic controls (NTg). The information of the primers used in genotyping was provided in Supplementary Table 1.
Ding M., Shi R., Cheng S., Li M., De D., Liu C., Gu X., Li J., Zhang S., Jia M., Fan R., Pei J, & Fu F. (2022). Mfn2-mediated mitochondrial fusion alleviates doxorubicin-induced cardiotoxicity with enhancing its anticancer activity through metabolic switch. Redox Biology, 52, 102311.
+ Open protocol
+ Expand
2

Evaluating Estrogen Receptor Modulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tamoxifen was obtained from MedChemExpress (HY-13757A). Fulvestrant was obtained from MedChemExpress (HY-13636). AZD9496 was obtained from MedChemExpress (HY-12870). NU7441, an inhibitor of DNA protein kinase catalytic subunit (DNAPKcs), was obtained from Selleckchem (Ku-57788). AZD7762, an inhibitor of Chk1/2, was purchased from Sigma (SML0350). β-estradiol was obtained from MedChemExpress (HY-B0141). All compounds were solubilized in DMSO.
Michmerhuizen A.R., Lerner L.M., Pesch A.M., Ward C., Schwartz R., Wilder-Romans K., Liu M., Nino C., Jungles K., Azaria R., Jelley A., Zambrana Garcia N., Harold A., Zhang A., Wharram B., Hayes D.F., Rae J.M., Pierce L.J, & Speers C.W. (2022). Estrogen receptor inhibition mediates radiosensitization of ER-positive breast cancer models. NPJ Breast Cancer, 8, 31.
+ Open protocol
+ Expand
3

Fate-mapping of Hematopoietic Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For fate-mapping analysis of HSCs, Fgd5CreERT2 mice were crossed with Rosa26-LSL-tdTomato reporter mice. To label the HSCs of newborns (1 d), 2.5 mg tamoxifen (MedChemExpress) was administered to dams by oral gavage three times within 24 h. To mark neonatal (1 wk) and adult (5 wk) HSCs, mice were injected i.p. with 500 µg tamoxifen (a single dose) and 2.5 mg tamoxifen (every 24 h for five consecutive days), respectively. To induce the labeling of YS Fgd5+ progenitors, pregnant females were injected i.p. with 1.25 mg 4-OHT (MedChemExpress) and 0.75 mg progesterone (MedChemExpress) on E8.5. For the induction of embryonic Ncr1 fate-mapping, Ncr1CreERT2 males were crossed with Rosa26-LSL-tdTomato females, followed by i.p. injection of pregnant mice with 1.5 mg 4-OHT and 1 mg progesterone on E17.5. Because 4-OHT treatment interferes with natural delivery, pups were delivered by cesarean section and fostered with lactating ICR females.
Chen Y., Wang X., Hao X., Li B., Tao W., Zhu S., Qu K., Wei H., Sun R., Peng H, & Tian Z. (2022). Ly49E separates liver ILC1s into embryo-derived and postnatal subsets with different functions. The Journal of Experimental Medicine, 219(5), e20211805.
+ Open protocol
+ Expand
4

Conditional Enhancer Deletion via Cre-loxP System

Check if the same lab product or an alternative is used in the 5 most similar protocols
The generation of the Cre-loxP–mediated SE-FGFR1 conditional enhancer-deletion (3,000 bp) cell line was carried out in two steps. First, the sgRNA-expressing vector targeting the mROSA26 locus and the donor vector containing 1,500- to 2,500-bp homology arms and Tamoxifen-induced Cre-expression cassettes (MerCreMer) were transfected into stem cells. For electric transfection, 3 × 106 cells in 250 μL electroporation buffer containing 15 μg plasmids were treated with 300 V for 1 ms in a 2-mm gap by BTX-ECM 830 (BTX). After 12 h, cells were washed and further incubated in the fresh medium. Further, cells were screened by 300 µg/mL G418 (Gibco) for 3 d. Second, the cassette (loxP-enhancer-loxP) was introduced into the PSCs through the same strategy (transfecting one donor vector and two sgRNA-expressing vectors targeting both sides of the SE-FGFR1 core subregion). After 72 h, limiting dilution was performed, and incubation was continued for 6 to 8 d. Individual colonies were picked, and genomic DNA was extracted for genotyping. Gene editing–positive colonies were expanded for further investigation (74 (link), 75 (link)). Tamoxifen (1 μM final concentration) was purchased from MedChem Express. Details on generation of other cell lines with enhancer deficiency can be found in SI Appendix, Materials and Methods.
Zhang J., Zhou Y., Yue W., Zhu Z., Wu X., Yu S., Shen Q., Pan Q., Xu W., Zhang R., Wu X., Li X., Li Y., Li Y., Wang Y., Peng S., Zhang S., Lei A., Ding X., Yang F., Chen X., Li N., Liao M., Wang W, & Hua J. (2022). Super-enhancers conserved within placental mammals maintain stem cell pluripotency. Proceedings of the National Academy of Sciences of the United States of America, 119(40), e2204716119.
+ Open protocol
+ Expand
5

Establishing Drug-Resistant Breast Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human breast cancer cells (BT-549, Hs578T, MDA-MB-231, MDA-MB-468, MDA-MB-436, MCF-7, and T47D) were obtained from the American Type Culture Collection (ATCC, USA). All cells were cultured in the recommended medium (Gibco, USA), supplemented with 10% fetal bovine serum (Gibco, USA) and 1% streptomycin/ penicillin (Beyotime, Shanghai, China) at 37 °C with 5% CO2. To establish cisplatin (DDP)-resistant MDA-MB-231 cell line (MDA-MB-231/DDP), doxorubicin-resistant BT549 cell line (BT-549/DOX) and tamoxifen-resistant MCF-7 cell line (MCF-7/TAM), MDA-MB-231, BT-549 and MCF-7 cells were exposed to repetitive and incremental concentrations of drugs over a period of 6 months. To maintain the resistance phenotype, MDA-MB-231/DDP, BT-549/DOX, and MCF-7R cells were, respectively, cultured in the presence of 2 μM cisplatin (Med-ChemExpress, NJ, USA), 2 μM doxorubicin (Med-ChemExpress, NJ, USA), and 1 μM tamoxifen (Med-ChemExpress, NJ, USA). Arachidonic acid was obtained from Sigma-Aldrich (St. Louis, MO, USA). Giripladib, an inhibitor of cytoplasm phospholipase A2, was purchased from USBiological Life Sciences (Swampscott, MA, USA).
Liu S., Sun Y., Hou Y., Yang L., Wan X., Qin Y., Liu Y., Wang R., Zhu P., Teng Y, & Liu M. (2021). A novel lncRNA ROPM-mediated lipid metabolism governs breast cancer stem cell properties. Journal of Hematology & Oncology, 14, 178.
+ Open protocol
+ Expand
6

Inhibiting Tumor Growth with Anti-TNF Antibodies

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice received an intraperitoneal injection of 200 μg of IgG control or anti-TNF antibodies (clone MP6-XT22, Biolegend) in 100 μL PBS 2.5 h before the tumor challenge (105 B16-F10 cells in 100 μL of PBS). Birinapant was dissolved in 12.5% captisol (5 mg/mL, Captisol, KS, USA) and used for intraperitoneal injections at 5 mg/kg after 1:10 dilution in PBS. Tamoxifen (Monmouth Junction, NJ, USA, MedChemExpress) was dissolved in corn oil (Sigma-Aldrich) at 20 mg/mL. Young mice (5 weeks old) were fed for 3 consecutive days by oral gavage (150 mg/kg).
Vasilikos L., Hänggi K., Spilgies L.M., Kisele S., Rufli S, & Wong W.W. (2021). Loss of cIAP1 in Endothelial Cells Limits Metastatic Extravasation through Tumor-Derived Lymphotoxin Alpha. Cancers, 13(4), 599.
+ Open protocol
+ Expand
7

Cytotoxicity Profiling of Antitumor Drugs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Four antitumor drugs including cobimetinib, copanlisib, selumetinib, and tamoxifen were purchased from MedChemExpress (Shanghai, China). For the CCK-8 assay, OS cells in the logarithmic growth phase were plated in 96-well plates and treated with different concentrations of drugs. After 72 h of drug induction, 10 µL CCK-8 solution was added to the cells and incubated for 2.5 h. The optical density (OD) at 490 nm was measured on a microplate reader. The IC50 value was calculated on the GraphPad Prism 9 software by non-linear regression analysis.
Su Z., Wang C., Pan R., Li H., Chen J., Tan J., Tian X., Lin T, & Shen J. (2022). The hexosamine biosynthesis pathway-related gene signature correlates with immune infiltration and predicts prognosis of patients with osteosarcoma. Frontiers in Immunology, 13, 1028263.
+ Open protocol
+ Expand
8

Modulating Tamoxifen and AZD8055 in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tamoxifen (CAY‐13258‐2, Cayman) was dissolved in sterile corn oil at a 25 mg/ml dosage and administered into mice through intraperitoneal injection at a 0.25 mg/g body weight. AZD8055 mTORC1/2 inhibitor (HY‐10422, MedChemExpress) was injected into mice via intraperitoneal injection 24 h prior to Tamoxifen treatment at a 10 mg/kg dose. After Tamoxifen injection, AZD8055 was reinjected 6 h later. Then, AZD8055 inhibitor was continuously injected every 12 h until the indicated day of tissue collection. AZD8055 was dissolved in the solution of 5% Tween20, 10% DMSO, 40% PEG300, and 45% saline. Naphthalene (176044, Sigma) was dissolved in corn oil and administered to mice through intraperitoneal injection at a 250 mg/kg body weight. Single dose of Naphthalene was injected and analyzed at day 5 and 14 post treatment. For repetitive injuries, Naphthalene was injected once a week for 5 weeks, and tissues were analyzed at 5 days after a final dose.
Jeon H.Y., Choi J., Kraaier L., Kim Y.H., Eisenbarth D., Yi K., Kang J., Kim J.W., Shim H.S., Lee J, & Lim D. (2022). Airway secretory cell fate conversion via YAP‐mTORC1‐dependent essential amino acid metabolism. The EMBO Journal, 41(8), e109365.
+ Open protocol
+ Expand
9

Culturing Tamoxifen-Resistant Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF7, T47D and HEK293T cells were obtained from the American Type Culture Collection (ATCC). MCF7, Tamoxifen-resistant MCF7 and HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; 01-052-1ACS, Biological Industries) supplemented with 10% fetal bovine serum (FBS; 04-001-1ACS, Biological Industries), and T47D cells were cultured in RPMI 1640 medium (01-100-1ACS, Biological Industries) supplemented with 10% FBS. Tamoxifen-resistant MCF7 cells were developed by culturing MCF7 cells in the presence of 2 μM Tamoxifen (HY-13757A, MedChemExpress) for >12 months. Tamoxifen-resistant MCF7 cells were then maintained in the presence of 1 μM Tamoxifen. All cells were cultured in a humidified incubator with 5% CO2 at 37°C. If estrogen (E2, E8875, Sigma) was added, cells were maintained in stripping medium (phenol red free) plus 5% charcoal-depleted FBS for 72 h before treatment.
Zheng Z.Z., Xia L., Hu G.S., Liu J.Y., Hu Y.H., Chen Y.J., Peng J.Y., Zhang W.J, & Liu W. (2022). Super-enhancer-controlled positive feedback loop BRD4/ERα–RET–ERα promotes ERα-positive breast cancer. Nucleic Acids Research, 50(18), 10230-10248.
+ Open protocol
+ Expand
10

Cell Culture and Knockdown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Several human cell lines were used in our study. GBC‐SD, RBE, Patu8988, AsPC1 and HIBEpiC were obtained from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). NOZ was provided by the Health Science Research Resources Bank (Osaka, Japan). QBC‐939 and SGC‐996 were obtained by the Academy of Life Sciences, Tong Ji University (Shanghai, China). GBC‐SD, Patu8988, AsPC1 and HIBEpiC were maintained in DMEM, RBE, SGC‐996 and QBC‐939 were maintained in RPMI‐1640, and NOZ was cultured in William's E medium (Gibco, NY, USA), containing 10% foetal bovine serum (FBS) and antibiotics (Gibco, NY, USA). Phenol red‐free DMEM and Charcoal Stripped Fetal Bovine Serum (Gibco, NY, USA) were used in E2 treatment experiments. Cells were maintained in controlled humidified atmosphere with 5% CO2 under 37°C. Tamoxifen, compound C, DCFDA, NAC and 17β‐estradiol (E2) were purchased from Medchem Express (MCE, USA). For inhibition of AMPK or ERɑ, cells with 65%‐70% confluence were transfected with shRNAs (AMPK: CAGGCCCAGAGGTAGATAT and AGAGAAATTCAGAACCTCA; ERɑ: GCCCTACTACCTGGAGAACGA and CTACAGGCCAAATTCAGATAA) or corresponding controls (GenePharma, Shanghai, China) by Lipofectamine 2000 (Invitrogen). Experiments were performed in accordance to the manufacturer's instructions. After 48 hours, the cells were collected and applied to subsequent experiments.
Huang S., Wang H., Chen W., Zhan M., Xu S., Huang X., Lin R., Shen H, & Wang J. (2019). Tamoxifen inhibits cell proliferation by impaired glucose metabolism in gallbladder cancer. Journal of Cellular and Molecular Medicine, 24(2), 1599-1613.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!