Cdna reverse transcription kit

Total RNA isolation from A549 cells was performed using TRIzol Reagent (Invitrogen, USA) then cDNA synthesis was performed using a cDNA reverse transcription kit (TIANGEN, China). Next, quantitative real-time PCR (qRT-PCR) was performed using a 2× Taq Plus PCR MasterMix kit (TIANGEN, China) and PCR primers with sequences as listed in Table 1.

Total RNA of RAW264.7 cells was extracted with TRIzol reagent (Invitrogen, USA). Reverse transcription was performed with a cDNA Reverse Transcription Kit (TIANGEN, China) according to the manufacturer’s instructions. Quantitative real-time PCR was carried out using Applied Biosystems 7300 (Life Technologies, USA). The reaction mixture was performed with SYBR® Premix Ex Taq™ (TaKaRa, China) according to the manufacturer’s protocols. The reaction conditions were 40 cycles of two-stage PCR consisting of denaturation at 95 °C for 15 s and annealing at 60 °C for 1 min after an initial denaturation step at 95 °C for 10 min The primer sequences were as follows: mouse TNF-α, forward 5‘ggcggtgcctatgtctcag3’ and reverse 5‘ggctacaggcttgtcactcg 3’; mouse IL-10, forward 5‘acatactgctaaccgactcct3’ and reverse 5‘ggtcttcagcttctcaccc3’; mouse IL-12p40, forward 5‘atgtggaatggcgtctc3’ and reverse 5‘gtctcctcggcagttgg3’; and mouse β-actin, forward 5‘agagggaaatcgtgcgtgac 3’ and reverse 5‘cgctcgttgccaatagtgat3’. For the relative comparison of mRNA expression levels, the data were analyzed with a ΔΔCt method and normalized to the amount of β-actin cDNA as an endogenous control.

Total mRNA isolation from OVCAR-3 cells was performed using Trizol Up reagent (TransGen Biotech) and samples were reverse-transcribed using a cDNA reverse transcription kit (Tiangen Biotech) according to the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) analyses of histamine receptors and ERs were performed using the TransStart^® Green qPCR SuperMix (Bio-Rad Laboratories, California, USA). The primer pairs used for the amplification of the target genes are presented in Supplementary Table 2.

The DNA/RNA isolation kit (Tiangen, Beijing, China) was used to extract total RNA. Primers were designed and synthesized by TIANGEN BIOTECH Co., LTD). The following primers were used: U6 forward, 5′-CTGGCTTCGGCAGCACA-3′; reverse, 5′-AACGCTTCACGAATTTGCGT-3′. has-miR-195-3p primer sequence: forward, 5′-CCAAUAUUGGCUGUGCUGCUCC-3′. RNA was reverse transcribed into cDNA using a cDNA reverse transcription kit (Tiangen) following the manufacturer’s instructions. The following primes were used: BDNF (GeneCopoeia, Guangzhou, China) forward, 5′-GGCTTGACATCATTGGCTGAC-3′, reverse, 5′-GCCGAACTTTCTGGTCCTCAT-3′; GAPDH forward, 5′-GCACCGTCAAGGCTGAGAAC-3′, reverse, 5′-TGGTGAAGACGCCAGTGGA-3′. The RT-qPCR reaction system (20 µL) contained 2 µL cDNA, according to the manufacturer’s instructions. U6 or GAPDH served as internal controls. The relative transcription levels of target genes were calculated using the 2−ΔΔCq method. ΔΔCq was calculated using the following equation: ΔΔCq = [Cq (target gene) − Cq (internal reference gene)] experimental group − [Cq (target gene) − Cq (internal reference gene)] control group.

Total RNA was extracted using TRIzol following manufacturer’s instructions (15596026, Invitrogen, Waltham, MA, USA). cDNA was synthesized with a cDNA reverse transcription kit (KR116-02, Tiangen, China) from 2 μg total RNA. The qPCR was performed using SYBR Green (AQ601, TransGen Biotech, Beijing, China) and the LC96 real-time PCR detection system (Roche, Mannheim, Germany) according to provided instructions.

According to the manufacturer’s suggested protocol, the total RNA of exosomes, cells, and brain tissues was extracted with an EasyPure miRNA Kit (ER601, Transgenic, Beijing, China). The concentration and purity of samples were quantified using a Nanodrop ND-2000 (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription was carried out using a cDNA reverse transcription kit (Tian Gen, Beijing, China). The cycle threshold was detected by a Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). All mRNA levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primers of inflammatory mediators were designed and synthesized by Sangon Biotech (Shanghai, China). For miR-124 detection, cDNA reverse transcription and RT-PCR analysis were carried out using the Hairpin-it miR-124 RT-PCR Quantitation Kit (GenePharma, Shanghai, China). U6 was regarded as the control. The details of primer sequences are listed in Table 1. The data were analyzed with the 2^{−△△ Ct} method.