Primescript master mix

Total RNA was isolated using RNAiso Plus reagent (Takara Biotechnology Co., Ltd., Dalian, China) from the HCC cell lines or frozen tissue samples according to the manufacturer's protocol. Reverse transcription was conducted with PrimeScript™ Master Mix (Takara Biotechnology) at 37°C for 15 min. Gene mRNA levels were determined using SYBR Premix EX Taq™ II (Takara Biotechnology) on a Bio-Rad IQ™5 detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The PCR conditions were as follows: Pre-denaturation at 95°C for 30 sec; 40 cycles of denaturation (95°C for 5 sec), annealing (60°C for 30 sec). β-actin was used as a quantitative control to normalize the mRNA expression levels of the target genes. All experiments were performed according to the manufacturer's instructions. The data were analysed with the comparative Ct (2^−∆∆Cq) method. The primer was designed and synthesized by Shanghai Genechem Co., Ltd., for CDCA5 (forward primer, GACGCCAGAGACTTGGAAATG and reverse primer, GGACCTCGGTGAGTTTGGAG); β-actin (forward primer, CATGTACGTTGCTATCCAGGC and reverse primer, CTCCTTAATGTCACGCACGAT).

NP cells were treated with melatonin (10 µM) or TGF-β1 (10 ng/ml) for 24 h. Following treatment, total RNA was extracted from NP cells using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), following the manufacturer's protocol. A total of 1 µg of total RNA was then incubated with the Prime Script™ Master Mix (Takara Bio, Inc.) to synthesize complementary DNA by RT. Gene expression was determined by qPCR using the SYBR Premix Ex Taq kit (Takara Bio, Inc.). The thermocycling conditions were as follows: Initialization at 95˚C for 3 min, followed by 40 cycles of 95˚C for 30 sec, 55˚C for 20 sec and 72˚C for 20 sec, with a final amplification at 95˚C for 15 sec. Gene expression was determined using the 2^-ΔΔCq method (22 (link)). The primers were designed and selected using BLAST (https://blast.ncbi.nlm.nih.gov). Primer sequences are listed in Table I. GAPDH was used as an internal control.

Total RNA was extracted using TRIzol reagent (Invitrogen) in accordance with the manufacturer's instructions and then reverse‐transcribed into cDNA using a PrimeScript™ Master Mix (RR036A, TaKaRa). cDNA was then run on standard qPCR instruments. qPCR primer sequences used in our experiments are listed as follows: KIFC1 forward primer (F): 5′‐ACTACAGTGCCACAGACA‐3′; KIFC1 reverse primer (R): 5′‐CCTGATGTGCCAGACTTC‐3′; GAPDH F: 5′‐GGAGCGAGATCCCTCCAAAAT‐3′; GAPDH R; 5′‐GGCTGTTGTCATACTTCTCATGG‐3′; E‐cadherin F: 5′‐CGAGAGCTACACGTTCACGG‐3′; E‐cadherin R: 5′‐GGGTGTCGAGGGAAAAATAGG‐3′; α‐Catenin F: 5′‐GGGGATAAAATTGCGAAGGAGA‐3′; α‐Catenin R: 5′‐GTTGCCTCGCTTCACAGAAGA‐3′; β‐Catenin F: 5′‐AAAGCGGCTGTTAGTCACTGG‐3′; β‐Catenin R: 5′‐CGAGTCATTGCATACTGTCCAT‐3′; N‐cadherin F: 5′‐TCAGGCGTCTGTAGAGGCTT‐3′; N‐cadherin R: 5′‐ATGCACATCCTTCGATAAGACTG‐3′; Vimentin F: 5′‐GACGCCATCAACACCGAGTT‐3′; Vimentin R: 5′‐CTTTGTCGTTGGTTAGCTGGT‐3′; Fibronectin F: 5′‐CGGTGGCTGTCAGTCAAAG‐3′; Fibronectin R: 5′‐AAACCTCGGCTTCCTCCATAA‐3′; Snail F: 5′‐TCGGAAGCCTAACTACAGCGA‐3′; Snail R: 5′‐AGATGAGCATTGGCAGCGAG‐3′; Slug F: 5′‐CGAACTGGACACACATACAGTG‐3′; Slug R: 5′‐CTGAGGATCTCTGGTTGTGGT‐3′. Expression data were showed as 2^{−[(Ct of gene) − (Ct of GAPDH)]} and then analyzed.

Total RNA was isolated using RNAiso Plus (Takara, Shiga, Japan) reagent as directed by the manufacturer. cDNA was synthesized from 500 ng of RNA per sample using the Prime Script Master Mix (Takara). Then, quantitative PCR was conducted using a SYBR Green PCR kit (Takara) in a CFX200 (Bio-Rad, Hongkong, China). Each gene's mRNA level was normalized to those of the housekeeping gene GAPDH. The sequences of the primers are listed in Supplementary Table 1.