The largest database of trusted experimental protocols

7 protocols using dharmafect duo transfection reagent

1

Generating Axl CRISPR knockout cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To construct Axl CRISPR clones, Py8119 cells were transfected with the mCMV promoter driving Edit-R Cas9 expression plasmid with a puromycin resistance marker (GE Life Sciences) using the DharmaFECT Duo Transfection Reagent (GE Life Sciences). After 72 h, cells were treated with 6 μg ml−1 puromycin for 5 days. Cells growing under selection were then transfected with Axl targeting crRNA (GCGCCAACCACCAGGCCAGCGUUUUAGAGCUAUG CUGUUUUG) and tracrRNA (GE Life Sciences) using DharmaFECT Duo Transfection Reagent. After 5–7 days cells were analysed by flow cytometry to verify population of cells with absent Axl surface expression. Cells with no Axl expression were sorted, single cell dilutions were plated in 96-well plate, clones were grown for 10–14 days and clones were screened for Axl expression by flow cytometry.
+ Open protocol
+ Expand
2

Generating Cox2 CRISPR Clones in D4Ms

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate Cox2 CRISPR clones, D4Ms were transfected with an Edit-R Cas9 expression plasmid with a puromycin resistance marker, crRNAs for Cox2 (Dharmacon), and tracrRNA using DharmaFECT Duo Transfection Reagent (GE Life Sciences) following company recommended protocols.
+ Open protocol
+ Expand
3

Antibody Sources and Reagents Used

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flag antibody was from Sigma-Aldrich (St. Louis, MO, USA), the 4G10 and GST antibodies were from Millipore (Bilerica, MA, USA), GAPDH and V5 antibodies were purchased from MBL (Woods Hole, MA, USA), Fyn antibody was from Santa Cruz Biotechnology (Santa Cruz, CA, USA), LC3 antibody was from Novus Biologicals (Littleton, CO, USA) and p62 antibody was from Enzo Life sciences (Exeter, UK). All other antibodies were purchased from Cell Signaling (Boston, MA, USA). Bafilomycin A1 and AICAR were from Sigma-Aldrich (St. Louis, MO, USA). TNFα and Metformin were from EMD Millipore (Bilerica, MA, USA), Toronto Research Chemicals (Toronto, Ontario, Canada) and Cayman Chemical (Ann Arbor, MI, USA) respectively. Leupeptin Hemisulfate was from Fisher Scientific (Pittsburgh, PA, USA). DharmaFECT Duo Transfection Reagent and siRNAs for AMPKα1, α2 and Fyn were purchased from GE Healthcare (Little Chalfont, UK). X-tremeGENE HP DNA Transfection Reagent were from Roche (Basel, Switzerland). All other reagents were purchased from Sigma-Aldrich.
+ Open protocol
+ Expand
4

miRNA Regulation of Luciferase Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
CHO-K1 cells were obtained from the Korean Cell Line Bank (KCLB No. 10061) and cultured in Ham’s F-12 medium containing 10% fetal bovine serum and 1 × Antibiotic-Antimycotic (Life Technologies). Human mirVANA miRNA mimics were obtained from Life Technologies. These included hsa-miR-96 (assay ID: MC10422), hsa-miR-182 (assay ID: MC12369), hsa-miR-183 (assay ID: 12830), and negative control #1 (cat# 4464058). Cells were plated at a density of 2.5 × 103 in 48-well plates on day 0. On day 2, pGLO plasmids (0.3 μg/well) and mirVANA miRNA mimics (0, 1, 3, 10, and 20 nM) were transfected into cells using DharmaFECT-Duo Transfection Reagent (GE Healthcare). Cell lysates were prepared in 1× lysis buffer (Promega). Firefly luciferase and Renilla luciferase activities were measured using a Dual-luciferase System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity.
+ Open protocol
+ Expand
5

miR-200a Inhibition and Cell Proliferation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rat LA7 cells (obtained directly from ATCC, catalog #: CRL-2283), which were originally derived from a DMBA-induced mammary tumor in a Sprague Dawley rat, and human MCF7 cells (obtained directly from ATCC, catalog #: HTB-22) were used in in vitro experiments. MicroRNA-200a inhibition was performed using 5nM miR-200a-targeting and non-targeting control power inhibitors (Exiqon), transfected in tandem with a synthetic miR-200a target RenSP luciferase reporter plasmid (Switchgear Genomics, Carlsbad, CA) at a ratio of 1:5 (ng:nL) with Dharmafect Duo transfection reagent (GE Healthcare, Pittsburgh, PA). Twenty-four hours after transfection, cells were seeded into two separate 96-well plates, one for luciferase readout to verify miRNA inhibition and one for proliferation analysis. Luciferase and proliferation analyses were done 24 hours after reseeding, for a total of 48 hours after miRNA inhibition. RenSP luciferase signal was analyzed using LightSwitch Assay Reagent (Switchgear Genomics) according to manufacturer protocol. Cellular proliferation was measured using a BrdU ELISA kit (Roche, Basel, Switzerland) following manufacturer protocol.
+ Open protocol
+ Expand
6

MARCKS siRNA Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human MARCKS small interfering RNA (siRNA; 5′‐GGU GCC CAG UUC UCC AAG AUU‐3′), and nontargeting control siRNA (5′‐CGC ACC AGA ACA AAC ACA UU ‐3′) were used as previously described.18 Rat‐specific MARCKS siRNA was designed and purchased from GE Healthcare (Catalog No.: M‐11507500; Waukesha, WI). Cells were transfected with 100 nmol/L of siRNA with or without plasmids in Opti‐MEM (Invitrogen, Carlsbad, CA) for 24 hours using the DharmaFECT‐Duo transfection reagent, following the manufacturer's instructions (GE Healthcare).
+ Open protocol
+ Expand
7

Analyzing miR-29a targets in pancreatic cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 3′UTR containing predicted miR-29 binding sites, both wild type and mutant, for ATG9A and TFEB were cloned into pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, #E1330) downstream of the firefly luciferase open reading frame. 5×103 pancreatic cancer cells per well (Panc-1 or MIA PaCa-2) were plated in 96 well plates and grown at 37°C for 24 hours. Cells were then co-transfected for 24hrs with 10nM mimic control or miR-29a mimic and 100ng of pmirGLO Dual-Luciferase miRNA Target Expression Vector containing each respective 3′UTR binding site using DharmaFECT Duo Transfection Reagent (GE, T-2010-02). Cells were transfected for 24 hours, and luciferase levels were measured 24 hours post-transfection using Dual-Glo® Luciferase Assay System (Promega, #E2920). Firefly luciferase luminescence was normalized to renilla luciferase activity for each transfected well.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!