Shrimp alkaline phosphatase

Plasmids (5 µg) were digested with appropriate restriction enzymes followed by dephosphorylation of the ends with shrimp alkaline phosphatase (SAP) (Promega). The desired fragments were gel purified and radiolabeled with 30 units of polynucleotide kinase (NEB) and 50 µCi of adenosine 5′-[γ-³²P]triphosphate (PerkinElmer). The labeled fragment was purified through G-50 columns (Roche Diagnostics Corporation). Further details were as described previously (17 (link)).

Polymerase chain reactions (PCRs) to amplify the 17 exons of genomic COLQ were performed using previously described primers and protocols.5 Primers to amplify the last 7 exons of the COLQ transcript were designed with the forward primer (5′ GGGCAGAAAGGTGAAATGGGT) spanning the exon 10 and 11 junction and the reverse primer located in exon 17 (5′ ATGTGAAGTAGCGGCAGGAC). A constitutively expressed gene (PSMB7) was used to ensure that cDNA was present. Amplicons were reamplified using band‐stab PCR. Products were purified using an ExoSAP master mix consisting of 0.5 units of Exonuclease I (New England BioLabs, Ipswich, Massachusetts) and 0.25 units of shrimp alkaline phosphatase (SAP, Promega, Madison, Washington). Sequencing products were resolved on an ABI 3730XL DNA Analyzer (Applied Biosystems, Foster City, California). The c.880 G>A variant was genotyped in the remaining 3 affected puppies and 63 unaffected GRs using Sanger sequencing. We further investigated the presence of the variant in a variant call file containing single nucleotide polymorphisms and small insertions and deletions identified in the genomes of 668 domestic dogs, including 20 purebred GR, and 54 wild canids.16 In silico programs, PolyPhen‐217 and CPD prediction tool,18 were used to assess the impact of the variant.

Three pairs of primers to detect kdr west and kdr east mutation, rdl Ala296Gly and rdl Ala296Ser mutation, and ace-1 G119S mutation were used (Table 1) (Bass et al., 2007 (link); Bass et al., 2015a ; Bass et al., 2015b ). Multiplex PCR was performed in a volume of 20 μl containing 1x GC-I buffer (Takara, Japan), 3.0 mM Mg2+ (Takara, Japan), 0.3 mM dNTP (Generay Biotech, Shanghai), 1 U Hot Star Taq polymerase (Qiagen, Germany), 1 µl of template DNA and 1 µl of primers (Sangon Biotech, Shanghai) (Table 1). Thermal cycler conditions were: 95°C for 2 min; 11 cycles of 94°C for 20 s, 65°C for 40 s, and 72°C for 1.5 min; 24 cycles of 94°C for 20 s, 59°C for 30 s, and 72°C for 1.5 min; and finally 2 min at 72°C. Multiplex PCR products were separated by electrophoresis on 2% agarose gels stained with ethidium bromide (Sangon Biotech, Shanghai). The remaining PCR products were purified with 5 units of shrimp alkaline phosphatase (SAP) (Promega, USA) and 2 units of exonuclease I (EXO I) (Epicentre, USA) at 37°C for 1 h and 75°C for 15 min, to remove excess dNTPs and primers, respectively.