The largest database of trusted experimental protocols

Hylorondase

Manufactured by Thermo Fisher Scientific

Hylorondase is a laboratory enzyme that catalyzes the hydrolysis of hyaluronic acid. It is used to reduce the viscosity of biological samples containing hyaluronic acid.

Automatically generated - may contain errors

4 protocols using hylorondase

1

CRISPR-Based Gene Editing in Mouse Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
C57BL/6J or C57BL/6J C3H/HeJ F1 mice were crossed to C57BL/6J stud males and pronuclear stage embryos were dissociated from cumulus cells using Hylorondase (Fisher, Cat # MR-0510F). After the zona was weakened with acid Tyrode’s (Sigma Aldrich, Cat # T1788), the embryos were subsequently washed in M2 buffer. Cas9 RNP complexes were then assembled in vitro by combining 40uM of Cas9 protein with 2ug of sgRNAs targeting Klf5 (CCAGACCGUCCAUGCCCACG, AGCACCCGCGUGGGCAUGGA, GGUC AGCACCCGCGUGGGCA, Synthego). Assembled RNPs were then mixed with a cohort of 50–75 embryos, and electroporated with standard parameters (Modzelewski et al., 2018 (link)). Electroporated embryos were then cultured in KSOM until E3.5, at which point they were processed for IF analysis described above.
+ Open protocol
+ Expand
2

Embryo Manipulation via siRNA Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
5IU of PMSG (Prospec Cat# HOR-272) and HCG (Sigma-Aldrich, Cat # CG5–1VL) were injected intraperitoneally into 4–5 week old, wild-type C57BL/6J female or or C57BL/6J C3H/HeJ F1 mice 46–48h apart. Immediately following HCG injection, females were paired with C57BL/6J stud males and pronuclear stage embryos together with cumulus cell clusters were harvested from plugged females 20h after the mating. Pronuclear stage embryos were dissociated from cumulus cells using Hylorondase (Fisher, Cat # MR-0510F). Embryos were then incubated at 37C with 5% CO2 while siRNAs were prepared for injection. Before injection, scrambled siRNA (Thermo Fisher Scientific, Cat# AM4611) and Klf5 siRNAs (Thermo Fisher Scientific, Cat# 160900) and Klf4 siRNAs (Thermo Fisher Scientific, Cat# 156021) were prepared at a working concentration of 100uM were spun at 10k rpm for 5 min to clear debris. In experiments when we double knocked down Klf4 and Klf5, we prepared siRNA mixtures containing 50 uM Klf4 siRNAs and 50 uM Klf5 siRNAs. After the microinjection of siRNAs, embryos were cultured in vitro to E4.0, and then subjected to IF analyses described above.
+ Open protocol
+ Expand
3

CRISPR-Based Gene Editing in Mouse Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
C57BL/6J or C57BL/6J C3H/HeJ F1 mice were crossed to C57BL/6J stud males and pronuclear stage embryos were dissociated from cumulus cells using Hylorondase (Fisher, Cat # MR-0510F). After the zona was weakened with acid Tyrode’s (Sigma Aldrich, Cat # T1788), the embryos were subsequently washed in M2 buffer. Cas9 RNP complexes were then assembled in vitro by combining 40uM of Cas9 protein with 2ug of sgRNAs targeting Klf5 (CCAGACCGUCCAUGCCCACG, AGCACCCGCGUGGGCAUGGA, GGUC AGCACCCGCGUGGGCA, Synthego). Assembled RNPs were then mixed with a cohort of 50–75 embryos, and electroporated with standard parameters (Modzelewski et al., 2018 (link)). Electroporated embryos were then cultured in KSOM until E3.5, at which point they were processed for IF analysis described above.
+ Open protocol
+ Expand
4

Embryo Manipulation via siRNA Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
5IU of PMSG (Prospec Cat# HOR-272) and HCG (Sigma-Aldrich, Cat # CG5–1VL) were injected intraperitoneally into 4–5 week old, wild-type C57BL/6J female or or C57BL/6J C3H/HeJ F1 mice 46–48h apart. Immediately following HCG injection, females were paired with C57BL/6J stud males and pronuclear stage embryos together with cumulus cell clusters were harvested from plugged females 20h after the mating. Pronuclear stage embryos were dissociated from cumulus cells using Hylorondase (Fisher, Cat # MR-0510F). Embryos were then incubated at 37C with 5% CO2 while siRNAs were prepared for injection. Before injection, scrambled siRNA (Thermo Fisher Scientific, Cat# AM4611) and Klf5 siRNAs (Thermo Fisher Scientific, Cat# 160900) and Klf4 siRNAs (Thermo Fisher Scientific, Cat# 156021) were prepared at a working concentration of 100uM were spun at 10k rpm for 5 min to clear debris. In experiments when we double knocked down Klf4 and Klf5, we prepared siRNA mixtures containing 50 uM Klf4 siRNAs and 50 uM Klf5 siRNAs. After the microinjection of siRNAs, embryos were cultured in vitro to E4.0, and then subjected to IF analyses described above.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!