Reporters containing target sequences of interest were prepared as previously described (Ramakrishna et al. 2014 (link)). Briefly, oligonucleotides containing target sequences (Fig. 1 ; Supplemental Fig. S3 ) were synthesized (Bioneer) and annealed in vitro in a thermocycler. The annealed oligonucleotides were ligated into the pRGS vector (Ramakrishna et al. 2014 (link)) predigested with EcoR1 and BamH1. HEK293T cells were transfected with mixtures of the Cas9-puro, U6-sgRNA, and reporter plasmids at a weight ratio of 1:1:1 using Neon electroporation (Invitrogen). Three days after transfection, adherent cells were trypsinized and resuspended in Ca2+- and Mg2+-free PBS (Gibco-BRL) supplemented with 2% FBS. Single-cell suspensions were analyzed with FACSAria II (BD Biosciences). We then calculated the percentage of mRFP+eGFP+ cells among the total population of mRFP+ cells, which represented the activity of the guide RNA on the target sequence.
Neon electroporation
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Neon electroporation is a laboratory instrument designed for the introduction of macromolecules, such as DNA, RNA, or proteins, into cells. It utilizes electrical pulses to create temporary pores in the cell membrane, allowing the transfer of the desired materials into the cells.
Automatically generated - may contain errors
Lab products found in correlation
Genejet pcr purification kit, by Thermo Fisher Scientific (2 mentions)
Primestar gxl dna polymerase, by Takara Bio (2 mentions)
Quick dna microprep kit, by Zymo Research (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Ca2 and mg2 free pbs, by Thermo Fisher Scientific (1 mentions)
Facsaria 2, by BD (1 mentions)
Geneart genomic cleavage detection kit, by Thermo Fisher Scientific (1 mentions)
Tapestation 2200, by Agilent Technologies (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Hepg2, by Thermo Fisher Scientific (1 mentions)
Hepg2, by American Type Culture Collection (1 mentions)
Mia paca 2 cell, by American Type Culture Collection (1 mentions)
Aspc 1, by American Type Culture Collection (1 mentions)
2 3 cgamp, by Thermo Fisher Scientific (1 mentions)
Viafect transfection reagent, by Promega (1 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Muta direct site directed mutagenesis kit, by iNtRON Biotechnology (1 mentions)
Blasticidin, by Thermo Fisher Scientific (1 mentions)
Facsmelody sorter, by BD (1 mentions)
Scrambled sirna, by Horizon Discovery (1 mentions)
17 protocols using neon electroporation
1
Measuring CRISPR Guide RNA Activity
2
Homologous Recombination Assay Using CRISPR-Cas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To create homologous recombination (HR) assays, two gRNAs target the sequence near the deletion site within the HLA-B gene were designed and synthesized18 (link). The Cas9 RNPs were then used to transfect cells via Neon® electroporation (Invitrogen, USA) for 24-well format electroporation transfection testing for B cell line. The genomic cleavage efficiency was then evaluated using the GeneArt® Genomic Cleavage Detection kit (ThermoFisher, USA) at 48 h post transfection. The cleavage efficiencies were calculated based on the relative agarose gel band intensity, which was quantified using a high sensitivity DNA chip on TapeStation 2200 (Agilent, USA). Cleaved efficiency was calculated following the manufacturer’s instruction. A program with voltage set at 1700 V, pulse width set at 20 ms, and one pulse was used for the subsequent study. The gRNA with highest editing was selected for the subsequent HR assays. For ssDNA target design, typically the mutation site was positioned at the center flanked by 67-nt to 30-nt on each side (Fig. 1C ). To measure homologous recombination efficiency, the ssDNA target was co-transfected with Cas9 RNPs into cells via electroporation. The genomic loci were PCR-amplified using the corresponding primers and then subjected to GeneArt® Genomic Cleavage Detection assay (ThermoFisher, USA) for restriction enzyme digestion.
3
Autophagy Induction in Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa, HepG2, AsPC-1, and MIA PaCa-2 cells were obtained from ATCC (Manassas, VA, USA) and cultured in high-glucose Dulbecco’s modified eagle medium (LM001-05, Welgene, Gyeongsan, South Korea) containing 10% (v/v) fetal bovine serum (Gibco, Carlsbad, CA, USA) and 1% penicillin/streptomycin (Hyclone, Waltham, MA, USA). For starvation to induce autophagy, cells were cultured in Earle’s balanced salt solution (EBSS; CA006-050, GenDEPOT, Katy, TX, USA). All cells were grown at 37 °C in a humidified atmosphere of 5% CO2 incubator. For infection of mCherry-GFP-LC3 adenovirus, HepG2 cells were seeded in 12-well plates and incubated with the adenovirus the following day for 16 h. For transfection of mCherry-WDFY and GFP-LC3 into HepG2 cells, Neon electroporation (Invitrogen, Carlsbad, CA, USA) was performed according to manufacturer’s directions.
4
Genetically Engineered cGAS and STING
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA encoding human cGAS and human STING were cloned by PCR and then were subcloned into N-Myc-pcDNA3.1(+)Myc-HisC (Thermo Fisher Scientific) and N-Flag-pcDNA3.1(+)Myc-HisC plasmids, respectively. The plasmid encoding HA-p21 was a gift from Dr. Jaewhan Song (Yonsei University, Korea). RFP-cGAS (plasmid # 86676) was purchased from Addgene. A MYC-cGAS mutant (E225A, D227A), MYC-cGAS mutant (siRNA-resistant), Flag-STING mutant (R284M), and Flag-STING mutant (L374A) were constructed using a Muta-DirectTM site directed mutagenesis kit (iNtRON Biotechnology, #15071). 2′3′-cGAMP was purchased from Invitrogen. HeLa cells were transfected using Neon electroporation (Invitrogen), Lipofectamine® 2000 transfection reagent (Invitrogen), or ViaFectTM transfection reagent (Promega) according to the manufacturers’ protocols.
5
Rapid Fluorescent Protein Tagging Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For rapid generation of multiple fluorescent protein‐tagged cellular markers, we cloned a sequence of P2A‐ScaI‐mEmeraldT2A‐Balsticidin resistance marker into the pFusionRed‐H2B expression construct (Evrogen, FP421). The ScaI site was then used to clone Mis12 and AurB in‐frame with the preceding P2A and the following T2A sequence. Cyclin A2dd and B1ddB2ko cells were transfected with 2 μg of the expression plasmids by NEON electroporation (Invitrogen) and grown for 2 weeks in medium containing 5 μg/ml blasticidin (Gibco). Fluorescent protein expressing cell lines were isolated by FACS sorting using a BD FACSMelody sorter according to the manufacturer's instruction.
6
AXL Gene Knockout by CRISPR-Cas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transfected by Neon electroporation (two pulses at 1200 V, 20 ms; Life Technologies), with two custom vectors harboring a CMV-dCas9-ELD-gRNA1 and CMV-dCas9-KKR-gRNA2 of AXL containing a guide sequence to AXL at exon 1: gRNA1 5′- TCCCTGGGTTGCCCACGAA − 3′ and gRNA2: 5′- GGGACTCACGGGCACCCTT − 3′. Following transfection, single GFP-positive cells were isolated by FACS after 48 h. Clones were screened for indels by PCR amplification of genomic DNA using the following primers: 5′- AAGGACAGGGTGGAACTGAGGGC − 3′ and 5′- TTCCATCACATGCTCAAAGCCGCA -3′. PCR products were Sanger sequenced. Positive AXL KO clones was also confirmed by next generation sequencing.
7
Knockdown of Ifi202b in SVF and BMMs
8
CRISPR Targeting of Key Immune Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR RNAs (crRNAs) targeting the CCR5, PRDM1, IRF4, PAX5, and BACH2 loci (sequences in Table S1 ) were identified using the MIT CRISPR design tool (http://crispr.mit.edu/ ) and the Broad Institute single guide RNA (sgRNA) design tool (http://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ) and synthesized (IDT) containing phosphorothioate linkages and 2′O-methyl modifications.26 (link) ssODNs were commercially synthesized by IDT (Ultramer DNA Oligonucleotides) with phosphorothioate linkages. crRNA and trans-activating crRNA (tracrRNA; IDT) hybrids were mixed with Cas9 nuclease (IDT) at a 1.2:1 ratio and delivered with or without ssODNs to cells by Neon electroporation (Thermo Fisher Scientific).
9
CRISPR-Cas9 Mediated Correction of iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRISPR-Cas9 machinery was delivered to iPSCs and analyzed as described previously [16 (link),17 (link),18 (link)]. Briefly, the sg4-spCas9 and HDR plasmids were transfected at a 1:2 molar ratio into patient iPSCs with Lipofectamine Stem (Thermo Fisher Scientific; Patient 1) or Neon electroporation (Thermo Fisher Scientific; Patient 2). Puromycin (0.5 μg/mL) selection was performed as previously described [16 (link)], and surviving colonies were PCR screened for HDR incorporation and sequenced to confirm correction. The puroR-vTK cassette was removed by Lipofectamine Stem transfection of Cre recombinase, and cells were treated with 40–400 nM Ganciclovir to select for those with vTK removal. The top off-target sites (Table S2 ) were determined using the Benchling platform (https://benchling.com/ ) and analyzed using the T7E1 assays as described above.
10
Generation of Murine and Human Melanoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
B16-F10, a murine melanoma cell line, was obtained from Cell Lines Services (Eppelheim, Germany), while 92-1, MEL202 and MP41, three human uveal cell lines, were obtained from the EACC and ATCC, respectively. UM22, a human UM cell line derived from a patient with UM [17 (link)], was grown in culture and used for further experiments. All cells were maintained in complete medium (RPMI-1640 supplemented with 10% FBS, glutamine, and gentamycin) and cultured at 37 °C with 5% CO2. Cell line validation was performed by RNAseq where known and unique combinations of GNAQ/GNA11/SF3B1/EIF1AX/BAP1 driver mutations were confirmed.
To generate a Cd274 (PD-L1) CRISPR/Cas9 knockout B16-F10 cell line, Cas9:crRNA:tracrRNA ribonucleoprotein complex was assembled according to the manufacturer’s recommendations (Integrated DNA Technologies, Coralville, IA) and transfected into cells using Neon electroporation (Thermo Fisher Scientific, Waltham, Massachusetts, USA). Negative cells were sorted for the absence of PD-L1 by staining with a PE-labeled anti-mouse PD-L1 antibody (clone MIH5; BD Biosciences, Franklin Lakes, New Jersey, USA) using a FACSAria III (BD Biosciences). The absence of PD-L1 expression in the PD-L1 knockout cells was confirmed in cells treated with entinostat (Selleck Chemicals, Houston, Texas, USA) to induce PD-L1.
To generate a Cd274 (PD-L1) CRISPR/Cas9 knockout B16-F10 cell line, Cas9:crRNA:tracrRNA ribonucleoprotein complex was assembled according to the manufacturer’s recommendations (Integrated DNA Technologies, Coralville, IA) and transfected into cells using Neon electroporation (Thermo Fisher Scientific, Waltham, Massachusetts, USA). Negative cells were sorted for the absence of PD-L1 by staining with a PE-labeled anti-mouse PD-L1 antibody (clone MIH5; BD Biosciences, Franklin Lakes, New Jersey, USA) using a FACSAria III (BD Biosciences). The absence of PD-L1 expression in the PD-L1 knockout cells was confirmed in cells treated with entinostat (Selleck Chemicals, Houston, Texas, USA) to induce PD-L1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!