Primescript reverse transcription polymerase chain reaction kit

Manufactured by Takara Bio

Sourced in Japan

The PrimeScript Reverse Transcription Polymerase Chain Reaction (RT-PCR) Kit is a laboratory tool used for the synthesis of complementary DNA (cDNA) from RNA templates and subsequent amplification of the cDNA through the polymerase chain reaction process. The kit contains the necessary reagents and enzymes required for these functions.

Automatically generated - may contain errors

Lab products found in correlation

3730xl automated sequencer, by Thermo Fisher Scientific (1 mentions) Takara ex taq polymerase, by Takara Bio (1 mentions) Bigdye terminator v3.1 sequencing kit, by Thermo Fisher Scientific (1 mentions) Seqman program, by DNASTAR (1 mentions) Trizol reagent, by Takara Bio (1 mentions) Sybr green master mix, by Roche (1 mentions) Sybr premix ex taq, by Takara Bio (1 mentions) Lightcycler 480 system, by Roche (1 mentions) Trizol reagent, by Solarbio (1 mentions)

Close spelling variants of this product

PrimeScript reverse transcription kit Reverse transcription reaction Reverse transcription kit PrimeScript kit Transcription kits

3 protocols using primescript reverse transcription polymerase chain reaction kit

Validating Gene Fusion Transcripts

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To discover gene fusion from RNA-seq data, we used DeFuse version 0.4.3 and ChimeraScan version 0.4.59 (link)10 (link).
In order to validate fusion transcript by Sanger sequencing, fusion candidate were selected. Fusion transcripts were observed only in cancer tissues, and protein coding transcripts were selected. Genes that were reported in cancer gene database (COSMIC, ChimerDB 2.0) and previous studied were validated.
For Sanger sequencing, 2 µg of total RNA was used for cDNA synthesis with an oligo-dT primer and PrimeScript reverse transcription polymerase chain reaction Kit (Takara, Kyoto, Japan) according to the manufacturer's protocol.
Fusion gene specific primer pairs and TAKARA Ex-Taq polymerase (Takara) were used for the PCR reaction. After purification, PCR products were sequenced with the BigDye Terminator v3.1 Sequencing Kit and a 3730xl automated sequencer (Applied Biosystems, Foster City, CA, USA). All DNA sequenced comparison alignments were performed using DNAstar SeqMan program (DNAstar, Madison, WI, USA).

Hong Y., Kim W.J., Bang C.Y., Lee J.C, & Oh Y.M. (2016). Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing. Tuberculosis and Respiratory Diseases, 79(2), 85-90.

+ Open protocol

+ Expand

Quantitative Real-Time PCR of Rat Brain

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative real-time PCR (qRT-PCR) was performed to verify the results of data mining of the GEO database. After the pain behavior measurement was completed, the rats were anesthetized by intraperitoneal injection of 10% chloral hydrate. The skin was cut quickly and carefully to avoid pressing the brain tissue after the rat's neck was cut off with a decapitator. Then, we insert the curved forceps into the gap between the skull and the medulla oblongata, lift off the rat's skull, and remove the remaining skulls. After full exposure of the rat brain tissue, peeling is performed, then the brain tissue is removed, the filter paper absorbs the water and blood on the surface, and it is placed in a freezer at -80°C for storage. The manufacturer's instructions extracted total RNA from brain tissues using Trizol reagent (Takara, Kyoto, Japan). cDNA was synthesized using the PrimeScript reverse transcription-polymerase chain reaction kit (Takara, Kyoto, Japan). The qRT-PCR was performed in SYBR Green Master Mix (Roche). The 2−∆∆Ct method was performed to analyze the data, and GAPDH was used as a loading control. The primer sequences are listed in Table 1.

Zhou D., Zhang L., Mao L., Cao J, & Gao J. (2022). Biological Mechanism on SIRT1/NLRP3/IL-18 Signaling Pathway of Acupuncture for Treatment of Ischemic Stroke with Center Poststroke Pain. Computational Intelligence and Neuroscience, 2022, 8958742.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total ribonucleic acid (RNA) was extracted from cells and frozen tissue samples using TRIZOL reagent (15596‐018; Solarbio, Beijing, China). Total RNA was reversely transcribed into complementary deoxyribonucleic acid using the PrimeScript™ reverse transcription polymerase chain reaction kit (Takara, Dalian, China). Quantitative polymerase chain reaction was carried out on a LightCycler 480 system (Roche Diagnostics GmbH, Mannheim, Germany) using the SYBR Premix Ex Taq™ (Takara Biotechnology Ltd., Dalian, China). Glyceraldehyde‐phosphate dehydrogenase was used as an internal reference to standardize the messenger RNA expression. The primers were designed and synthesized by Anhui General Biotechnology Co., Ltd (Anhui, China). Primer sequences for PTGS2 were forward: 5′‐GTGGAAAAGCCTCGTCCAGA‐3′ and reverse: 5′‐TCCTCCGAAGGTGCTAGGTT‐3′; for glyceraldehyde‐phosphate dehydrogenase were forward: 5′‐AGACAGCCGCATCTTCTTGT‐3′ and reverse: 5′‐TACGGCCAAATCCGTTCACA‐3′. The relative quantitative method (2−ΔΔCT method) was used to calculate the relative transcript level of the target gene.

Chen J., Guo P., Liu X., Liao H., Chen K., Wang Y., Qin J, & Yang F. (2023). Sinomenine alleviates diabetic peripheral neuropathic pain through inhibition of the inositol‐requiring enzyme 1 alpha–X‐box binding protein 1 pathway by downregulating prostaglandin‐endoperoxide synthase 2. Journal of Diabetes Investigation, 14(3), 364-375.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!