Takara epitaq hs

Genomic DNA was purified from MCF10A‐ErbB2, MCF10A‐RafCAAX, or MCF10A‐neo cells by using DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany). Bisulfite conversion of cytosine to uracil of the genomic DNA was performed with EpiTect Bisulfite kit (Qiagen) following the manufacturer's instruction. After cleanup of the bisulfite‐converted DNA, PCR was performed with the following primers: promoter A (forward: 5′‐TTAAATGTTAGGATAAGTTTTTGGTTG‐3′; reverse: 5′‐AACCTTACACCTAAAACCTTAATCCT‐3′) and promoter B (forward: 5′‐GGAGGTATGGAGTTGATAATTATGAG‐3′; reverse: 5′‐ACTATCTCTATTCCTAAATCAAAATTACTC‐3′). The PCR amplifications were performed in reaction volumes of 20 μL containing 2 μL 10 × EpiTaq PCR buffer Mg²⁺ free), 0.4 μm forward and reverse primers, 0.3 mm dNTP mixture, 2.5 mm MgCl₂, 0.025 U·μL⁻¹ TaKaRa EpiTaq HS (Takara Bio), and 2 μL template genomic DNA using MJ‐Mini thermal cycler. The thermal cycling conditions were an initial denaturation step at 95 °C for 10 min, followed by 45 cycles at 95 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s, and final extension at 72 °C for 10 min. The final PCR products were cloned into the T‐Vector pMD20 (Takara Bio), and about 10 clones per promoter were sequenced by Sigma‐Genosys (The Woodlands, TX, USA). The DNA methylation level was scored as percentage methylation of individual CpG units by using Quma (http://quma.cdb.riken.jp/).

Genomic DNA (2 µg) was modified by bisulfite treatment (EZ DNA methylation kit, Zymo Research) and amplified by either FastStart DNA polymerase (Roche) or Takara Epitaq HS (Takara Bio). Amplified products using universal bisulfite converted primers that equally detected methylated and unmethylated alleles were TA-cloned, transformed and single colonies were analyzed for CpG methylation by direct sequencing (ABI 3130) using T7 and Sp6 primers. Molecules (each represented by a row) are considered methylated if at least 50% of the CpGs (13/26 and 8/17 potential sites in regions E and F, respectively) remain unaltered after bisulfite conversion.

Genomic DNA was isolated from cells using the DNeasy, Blood and Tissue Kit as recommended by the manufacturer (Qiagen, Hilden, Germany). The DNA was treated with Sodium bisulfite using the EpiTect^RBisulfite Kit according to the manufacturer´s instructions (Qiagen, Hilden). The treated DNA (100 ng) was then used as a template in PCR reactions with bisulfite-PCR primers.
The FRK promoter region −1357 to +464 from the transcription site was analyzed using a bioinformatics tool [65 (link)]. Bisulfite-PCR primers were designed spanning the regions, +464/−502 and −541/−1112 of the FRK promoter TSS/+1 (Supplementary Table 2). PCRs were performed using TaKaRaEpiTaq^™ HS, as recommended by the manufacturer (TAKARA BIO INC, Tokyo Japan). The amplicons were resolved on agarose gels, purified using the QIAquick Gel Extraction Kit gel-extraction kit (Qiagen, Hilden) and sequenced (Supplementary Table 2).

After isolation from tumor tissue, DNA was treated with bisulfite using the MethylEdge Bisulfite Conversion System (Promega, Madison, WI, USA) following the manufacturer’s instructions. Bisulfite-treated DNA was afterward used for methylation-specific PCR (MSP).
Primer sequences of DKK1, DKK3, and GSK3β promoter region for MSP were synthesized according to [31 (link),32 (link),33 (link)], respectively (Table 1).
PCRs for bisulfite-treated DNA were performed using TaKaRa EpiTaq HS (TaKaRa Bio, USA): 1XEpiTaq PCR Buffer (Mg₂⁺ free), 2.5 mM MgCl₂, 0.3 mM dNTPs, 20 pmol of each primer (Sigma-Aldrich, USA), 50 ng of DNA, and 1.5 units of TaKaRa EpiTaq HS DNA Polymerase in a 25 µL final reaction volume. PCR cycling conditions are shown in Table 2.
PCR products were separated on 2% agarose gel stained with Syber Safe nucleic acid stain (Invitrogen, Thermo Scientific, Waltham, MA, USA) and visualized on a UV transilluminator. Methylated Human Control (Promega, Madison, WI, USA) was used as a positive control for the methylated reaction, while unmethylated DNA EpiTect Control DNA (Qiagen, Hilden, Germany) served as a positive control for the unmethylated reaction.

MSP and qMSP were performed using primers for methylated or unmethylated DNA designed using MethPrimer. Briefly, 2 μL of bisulfite-treated genomic DNA was amplified using TaKaRa EpiTaq HS (Takara Bio) under the following cycling conditions: 40 cycles of 98 °C for 10 s, 60 °C for 40 s, and 72 °C for 30 s. The PCR products were analyzed using 2% agarose gel electrophoresis. qMSP was performed using amfiSure qGreen Q-PCR Master Mix (GenDEPOT) and was monitored in real-time using an ABI 7300 Real-Time PCR System (Applied Biosystems). The cycling conditions were as follows: 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 34 s, and 72 °C for 30 s, followed by a single cycle of 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s to generate dissociation curves. Relative DNA methylation was calculated using the difference between the Ct values of the methylated and unmethylated PCR products. All measurements were performed in triplicate. The primer sequences used for MSP and qMSP are listed in Additional file 1: Table S2.

DNA was purified by phenol-chloroform extraction. Cells were lysed in lysis buffer (50 mM Tris-HCl (pH 7.8), 100 mM ethylenediaminetetraacetic acid (EDTA; pH 8.0), 100 mM NaCl, 1% SDS, and 500 μg/mL proteinase K) at 55 °C overnight. Bisulfite conversion was performed using the MethylEasy Xceed (Takara) according to the instructions provided by the supplier. The converted DNA was amplified by PCR using primers as described previously^{28 (link)}. PCR was performed using the TaKaRa EpiTaq HS (Takara) according to the protocol provided by the manufacturer. PCR products were cloned into bacteria using the TOPO TA Cloning Kit (Invitrogen). Eight clones for each sample were sequenced. The primer sequences that were used for PCR are listed in Supplementary Table 2.