Ten μg of total RNA isolated from primary microglial cells, were analyzed by electrophoresis on a 1.2% agarose gel with 0.4% formaldehyde, 1 × Morpholinepropanesulfonic acid(Mops). RNA was transferred to Hybond-N nylon membrane (Amersham, Piscataway, NJ) as previously described [7 (link),54 ]. To detect HIV-1 LTR and DING p27SJ RNAs, the membranes were hybridized with [32P]-labeled LTR DNA probe or DING p27SJ probe (800 bp). For the detection of GAPDH RNAs, the filters were probed with a PCR-amplified and [32P]-labeled GAPDH RNA, a housekeeping gene used as an internal control fragment. Radiolabeled DNA probes were prepared using Random Primed DNA Labeling Kit (Roche Molecular Biochemicals, Indianapolis, IN). Unincorporated radionucleotides were removed using MicroSpin™G-50 columns (Amersham). Housekeeping gene GAPDH was used as an internal control.
Microspin g 50 columns
Manufactured by Cytiva
The MicroSpin G-50 columns are a size-exclusion chromatography tool used for the purification and desalting of small molecules, peptides, and proteins. These columns are designed to efficiently remove unwanted salts, buffers, and other low molecular weight contaminants from samples, while retaining the target molecules of interest.
Automatically generated - may contain errors
Lab products found in correlation
Hybond n nylon membrane, by Cytiva (2 mentions)
Random primed dna labeling kit, by Roche (2 mentions)
Digital sonifier 450, by Emerson (2 mentions)
Fluo 5n, by AAT Bioquest (2 mentions)
Fluo 5n, by Cytiva (2 mentions)
Poly d lysine, by Merck Group (2 mentions)
Sybr green 1 master mix, by Roche (2 mentions)
Alexa fluor 488, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Salmon sperm dna, by Roche (1 mentions)
Perfecthyb plus hybridization buffer, by Merck Group (1 mentions)
Alexa fluor 546, by Thermo Fisher Scientific (1 mentions)
Alexa fluor 647 carboxylic acid, by Thermo Fisher Scientific (1 mentions)
T4 polynucleotide kinase, by Thermo Fisher Scientific (1 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
10 protocols using microspin g 50 columns
1
RNA Analysis of Microglial Cells
2
RNA Analysis of Microglial Cells
3
Stable Cell Line Generation by Piggyback Transposition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A375 cells were transfected with 0.9 µg of spGFP transposon and 0.1 µg of pCDNA-mPB (piggyBac transposase) and selected with 10 µg/mL Blasticidin for 3 weeks. Clones derived from single cells were picked using cloning cylinders and expanded. Genomic DNA was isolated with Proteinase K lysis buffer and 15 µg of DNA were digested overnight with 40 units of MspI (New England Biolabs, Cat. # R0106). Digested DNA was separated on a 0.8% agarose gel, followed by in-gel depurination, denaturation, and neutralization. DNA was capillary transferred in 10xSSC onto nitrocellulose membrane and crosslinked by baking at 70°C for one hour. A Blasticidin probe was PCR amplified, labelled with α-32P-dCTP using DECAprime II random prime labelling kit (Invitrogen, Cat. # AM1456) and purified with MicroSpin G-50 columns (Cytiva, Cat. # 27533001) using the manufacturers’ recommendations. The membrane was incubated with labelled probe and 250 µg/mL salmon sperm DNA (Roche, Cat. # 10223638103) at 65°C overnight in Perfecthyb Plus Hybridization Buffer (Millipore, Cat. # H7033-125ML), washed in 2xSSC plus 0.5% SDS, and exposed to X-ray film for 4 days.
4
Fluorescent Labeling of Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant proteins without a fluorescent tag were labeled by incubating with a 1:1 molar ratio of Alexa Fluor 488, Alexa Fluor 546, or Alexa Fluor 647 carboxylic acid (succinimidyl ester) (Thermo Fisher Scientific) for 1 h at room temperature with continuous stirring. Free dye was removed by illustra™ Microspin G-50 Columns (Cytiva).
5
Fluo-5N Incorporation into Proteoliposomes
6
Reconstituted Proteoliposomes for Ca2+ Influx
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fluo-5N was incorporated into 3a-reconstituted proteoliposomes and control liposomes by first thawing frozen liposomes at a ratio of ~1:20 (v:v) into modified sucrose formation buffer45 (link) 25 mM HEPES pH 7.4, 150 mM KCl, and 262 mM Sucrose with a final concentration of 25 uM Fluo-5N (Stock concentration 5 mM in DMSO, AAT Bioquest). Next, the liposome mixtures in Eppendorf tubes were placed in a foam flotation in an ice bath and sonicated with a Branson Digital Sonifier 450 for 30 seconds total (10% Amplitude, 10 second pulse with 59 second wait time). Excess (unincorporated) Fluo-5N was then removed using microspin G-50 columns (Cytiva). The sample was then diluted into solution containing 50mM HEPES, 300mM KCl, and 2mM EGTA, pH=7.4 and plated onto poly-D-lysine (Sigma-Aldrich, 1mg/ml) coated 96-well plates, and centrifuged (5,000 × g for 5 min) at room temperature. Ca2+ influx was measured upon addition of a 50 mM HEPES, 285 mM KCl, 10 mM CaCl2, pH=7.4 solution. Images were acquired every 3 seconds for a total of 150 seconds. Fluorescence intensity of each liposome was normalized to its average fluorescence prior to Ca2+ addition.
7
Strand-specific qPCR for tdilncRNA detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detection of tdilncRNAs was performed as previously described (Rossiello et al, 2017 (link)), with some modifications. Briefly, RNA samples were treated with DNase I (Thermo Scientific) at 37°C for 1 h. Next, 1 μg of total RNA was reverse transcribed using the Superscript First‐Stranded cDNA Synthesis Kit (Invitrogen) with strand‐specific primers. cDNA was passed on a MicroSpin™ G‐50 columns (Cytiva), and qPCR was performed using SYBR Green I Master Mix (Roche). A volume of cDNA corresponding to 20 ng of initial RNA was used. Each reaction was performed in triplicate. Rplp0 was used as a control gene for normalization.
qPCR primer sequences (5′−3′ orientation):
qPCR primer sequences (5′−3′ orientation):
Rplp0 Fw TTCATTGTGGGAGCAGAC.
Rplp0 Rv CAGCAGTTTCTCCAGAGC.
teloC Rv CCCTAACCCTAACCCTAA.
teloG Rv GGGTTAGGGTTAGGGTTA.
telo Fw CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT.
telo Rv GGCTTGCCTTACCCTTACCCTTACCC TTACCCTTACCCT.
8
LogD, Stability, and Plasma Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All experiments were performed as described before34 (link). In brief, the logD7.4 value was determined via an octanol/water partition assay and provided as mean value ± SD from three independent experiments, each performed in triplicates. The stability of [ 18 F]21 was determined by analytical radio-HPLC from human serum and human plasma samples (see Supplementary Fig. S5 ). The percentage of binding of [ 18 F]21 to human plasma proteins was determined by spin-column chromatography using MicroSpin™ G-50 columns (Cytiva, Amersham) and averaged in triplicate experiments.
9
Preparation of Radiolabeled Oligonucleotide Substrates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following synthetic oligonucleotides (Stab-Vida, Portugal) were used as substrates in the activity assays: 16-mer RNA (5'-GAA GCG AAA CCC UAAG-3'); 30-mer RNA (5'-CCC GAC ACC AAC CAC UAA AAA AAA AAA AAA -3'); 31-mer DNA (5'-GTC ATG ATC GCA GCG CAG CTG GCA ACG TGC G-3'). Each oligonucleotide was labelled at its 5′ end with [ 32 P]-γ-ATP and T4 Polynucleotide Kinase (Ambion) in a standard reaction. MicroSpin G-50 columns (Cytiva) were used to remove the excess of [ 32 P]-γ-ATP. In order to fold them into their secondary structures, the substrates were resuspended in 10 mM of Tris-HCl pH 8.0 and incubated 10 min at 80 °C followed by 30 min at 37 °C. The 31-mer DNA was also hybridized to the complementary nonlabelled 31-mer oligonucleotide (5′-CGC ACG TTG CCA GCT GCG CTG CGA TCA TGA C-3′) added in excess (molar ratio 1:10) in order to obtain a perfect 31-31ds duplex. The hybridization was performed during 10 min at 80 °C followed by 30 min at 37 °C. The formation of the DNA duplex was confirmed in 15% PAGE.
Vol.: (0123456789)
Vol.: (0123456789)
10
Detecting Telomeric Long Non-Coding RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detection of dilncRNAs was performed as previously described57 , with some modifications. RNA samples were treated with TURBODNAse (Thermo Scientific) at 37 °C for 1 h. Total RNA was reverse transcribed using the Superscript III reverse transcriptase (Invitrogen) with strand-specific primers. cDNA was purified on a MicroSpin G-50 columns (Cytiva). qPCR was performed using SYBR Green I Master Mix (Roche) with 20 ng of cDNA, using RPLP0 for normalization. Each reaction was performed in triplicate. Primer sequences are reported below (5’→ 3’):
RPLP0: TTCATTGTGGGAGCAGAC; CAGCAGTTTCTCCAGAGC
Telomeric RNA reverse transcription: CCCTAACCCTAACCCTAA or GGGTTAGGGTTAGGGTTA Telomeric repeats: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT; GGCTTGCCTTACCCTTACCCTTACCC TTACCCTTACCCT.
RPLP0: TTCATTGTGGGAGCAGAC; CAGCAGTTTCTCCAGAGC
Telomeric RNA reverse transcription: CCCTAACCCTAACCCTAA or GGGTTAGGGTTAGGGTTA Telomeric repeats: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT; GGCTTGCCTTACCCTTACCCTTACCC TTACCCTTACCCT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!