The largest database of trusted experimental protocols

7 protocols using hydroxylamine hcl

1

Preparation and Standardization of Fatty Acid Conjugates

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stock solutions of BSA-conjugated FAs or PacFA23 (link) (Avanti Polar Lipids, 900401P) were prepared in 0.15 M NaCl containing 10% (wt/vol) BSA (essentially FA free) at final concentrations of 5 or 10 mM54 (link). A stock solution of hydroxylamine HCl (2 M, Sigma-Aldrich, 159417) was freshly prepared in water and was adjusted to pH7.5 with NaOH. A stock solution of azathioprine (Sigma-Aldrich, A4638) was prepared in 0.1 M NaOH at a final concentration of 5 mM. Stock solutions of PalmB (20 mM, Merck, 178501), PP2 (20 mM, MCE, HY-13805), ML348 (10 mM, MCE, HY-100736), SP600125 (20 mM, ApexBIO, A4604), Dyngo4a (2 mM, Abcam, ab120689), and piceatannol (40 mM, MCE, HY-13518) were made up in DMSO. Bafetinib (Efebio, E074675) and entospletinib (Efebio, E012515) were prepared in 0.5% methyl cellulose in saline right before the oral gavage.
+ Open protocol
+ Expand
2

Synthesis and Characterization of Iron Oxide Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Iron acetylacetonate (Fe(acac)3 99%), 1,2-hexadecanediol (technical grade, 90%), oleic acid (technical grade, 90%), and oleylamine(technical grade, 70%), toluene (≥99.9%), chloroform (99%), dimethyl sulfoxide (DMSO 99%) benzyl ether (98%), hydrochloric acid, hydroxylamine HCl, sodium hydroxide, ammonium acetate, ferrozine, and thioglycolic acid (≥98%) were purchased from Sigma-Aldrich and used as received; DSPE-PEG 2000/5000 was purchased from Avanti Polar Lipids. Doxorubicin hydrochloride (98.0–102.0% HPLC) was purchased from Sigma-Aldrich and dissolved in an aqueous solution at 1 mg/ml.
+ Open protocol
+ Expand
3

Anaerobic Cultivation of E. coli Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols
All of the bacteria stocks used in the study, including E. coli H10407 (ATCC 35401) and 25922 (ATCC 25922) were either purchased from the American Type Culture Collection (Manassas, VA) or frozen stocks of clinical isolates stored in our laboratory. Brain heart infusion (BHI) medium was purchased from Becton Dickinson (Cockeysville, MD). Hydroxylamine-HCl and l-tryptophan were purchased from Sigma-Aldrich (St. Louis, MO). Anaerobic growth conditions were maintained at an atmosphere of 10% H2, 5% CO2, and 85% N2 in a Bactron-600 anaerobic chamber (Sheldon Manufacturing, Inc., Cornelius, OR).
+ Open protocol
+ Expand
4

Nocodazole, Biotin, and DSP Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stock solutions of nocodazole (1 mM, MCE, HY-13520), d-Biotin (200 mM, Sangon Biotech, A600078), and DSP (Thermo Scientific, 22586) were made up in DMSO. A stock solution of hydroxylamine HCl (2 M, Sigma-Aldrich, 159417) was freshly prepared in water and was adjusted to pH 7.5 with NaOH.
+ Open protocol
+ Expand
5

Preparation and Use of Immunostimulatory DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following reagents were purchased from the manufacturers as noted: DMXAA, BFA, hydroxylamine-HCl, poly (I:C) and nocodazole (Sigma); 2-BP (Wako); Palmitate [9,10-3H(N)] (American Radiolabeled Chemicals Inc); 2′,3′-cGAMP (InvivoGen); D-ceramide-C6 (Cayman); L-ceramide-C6 (Matreya Inc). ISD (90-mer), used as dsDNA in this study, was prepared as follows7 (link)38 (link): equimolar amounts of oligonucleotides (sense: 5′- TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA -3′, antisense: 5′- TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTATGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA -3′) were annealed in PBS at 70 °C for 30 min before cooling to room temperature.
+ Open protocol
+ Expand
6

Monocrotophos-Induced Oxidative Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols
Monocrotophos (Cat no. 36173), NAC (Cat no. A7260), acetylthiocholine (ATC) (Cat no. A5751), bovine serum albumin (BSA) (Cat no. A3059), triton-X-100 (Cat no. T8787), guanidine-HCl (Cat no. 50950), H2O2 (Cat no.1086001000), hydroxylamine-HCl (Cat no. V800215) and potassium bromide (KBr) (Cat no. 221864) were purchased from Sigma–Aldrich, St Louis, MO, USA. 5,5-dithiobis-2-nitrobenzoic (DTNB), nitro blue tetrazolium (NBT), thiobarbituric acid (TBA), ethylene diamine tetraacetic acid (EDTA), 2,4-dinitrophenylhydrazine (DNPH) and trichloroacetic acid (TCA) were purchased from Sisco Research Laboratory, Mumbai, India. Primary antibodies against Bax (Sc-493), Bcl-2 (Sc-783), Caspase-3 (Sc-7148), β-actin (Sc-4778) and HRP labeled secondary antibodies were purchased from Santa Cruz Biotechnology, Santa Cruz, CA, USA. AmershamProtran Nitrocellulose membrane (No-10600008) was purchased from GE healthcare Life Sciences, Germany. Glassware and plastic ware used in the study were autoclaved and sterilized before use.
+ Open protocol
+ Expand
7

Nitrocellulose Slide Preparation and Functionalization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Superfrost Plus glass slides were purchased from Fisher Scientific and rinsed with acetone, isopropanol and methanol prior to use. Two-pad and sixteen-pad Whatman FAST nitrocellulose slides, chloroauric acid trihydrate, hydroxylamine HCl, sodium borohydride, cysteamine, mercaptohexadecanoic acid, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide and N-hydroxysuccinimide (NHS) were purchased from Sigma-Aldrich. Ammonium hydroxide (30% ammonia) and Hyclone fetal bovine serum were purchased from Fisher Chemicals. IR800cw-NHS ester was purchased from Licor Biosciences. Six-armed PEG-amine was purchased from SunBio, and fetal bovine serum was purchased from Invitrogen.
Recombinant human insulin was purchased from Lilly, GAD65 and IA2 (ICA512) antigens were purchased from Kronus and tetanus toxoid antigen was purchased from Santa Cruz Biotech. Goat anti–human IgG, IgM and IgA antibodies were purchased from Vector Laboratories (Catalog # AI-3080, AI-3020 and AI-3030) and used at a final concentration of 1 nM.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!