The gRNA sequences are included in Supplementary Table 9 . These gRNAs were cloned into the LentiCRISPRv2 vector63 (link). CRISPR-Lenti nontargeting control plasmid was purchased from MilliporeSigma (Billerica, MA) (CRISPR12-1EA). MAX Efficiency DH5α (ThermoFisher Scientific, Cat# 18258012) were used to amplify plasmids. Lentiviruses were produced in the Viral Vector Core Laboratory of NIH/NIEHS or Baylor College of Medicine and were used to infect cells for the knockout of the specific gene. The pooled cells infected by gRNA were collected for western blot to confirm the knockout efficiency. Noninfected and gRNA-control-infected cells were used as controls.
Max efficiency dh5α
Manufactured by Thermo Fisher Scientific
Sourced in United States
The MAX Efficiency DH5α is a competent bacterial strain designed for high-efficiency transformation of DNA into E. coli cells. It is commonly used in molecular biology and genetic engineering applications.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by Thermo Fisher Scientific (2 mentions)
Crispr lenti nontargeting control plasmid, by Merck Group (1 mentions)
Fetal calf serum (fcs), by Natocor (1 mentions)
Dulbecco s modified eagle s medium dmem, by Thermo Fisher Scientific (1 mentions)
Gene art project, by Thermo Fisher Scientific (1 mentions)
Purelink hipure plasmid maxiprep kit, by Thermo Fisher Scientific (1 mentions)
Evos cell imaging system, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Lb medium, by MP Biomedicals (1 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)
One shot top10, by Thermo Fisher Scientific (1 mentions)
Zero blunt topo cloning kit, by Thermo Fisher Scientific (1 mentions)
Peak scanner, by Thermo Fisher Scientific (1 mentions)
Platinum taq dna polymerase high fidelity, by New England Biolabs (1 mentions)
Quick plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
Platinum taq dna polymerase high fidelity, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Kpni hf, by New England Biolabs (1 mentions)
Plasmid maxi kit, by Qiagen (1 mentions)
10 protocols using max efficiency dh5α
1
CRISPR-Lenti Knockout Protocol
2
Bacterial Culture and Cell Line Maintenance
Check if the same lab product or an alternative is used in the 5 most similar protocols
Escherichia coli strains used in this study (Max Efficiency™ DH5α, Thermo Fisher Scientific, Waltham, MA, USA) were grown at 37°C in lysogeny broth (LB) medium. Brucella suis M1330 (ATCC 23444) and derivative strains were grown at 37°C in Bacto tryptic soy broth (TSB; Bacto). When necessary, antibiotics were added: chloramphenicol at 6 µg/ml, kanamycin (Km) at 50 µg/ml, and nalidixic acid (Nal) at 10 µg/ml. All Brucella strains used in this study were handled in biosafety laboratories (BSL3) at Leloir Institute (IIBBA-FIL) and Instituto de Investigaciones Biomédicas en Retrovirus y SIDA (INBIRS). Eukaryotic cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 5% fetal calf serum (Natocor), at 37°C in a 5% CO2 atmosphere.
+ Expand
Escherichia coli strains used in this study (Max Efficiency™ DH5α, Thermo Fisher Scientific, Waltham, MA, USA) were grown at 37°C in lysogeny broth (LB) medium. Brucella suis M1330 (ATCC 23444) and derivative strains were grown at 37°C in Bacto tryptic soy broth (TSB; Bacto). When necessary, antibiotics were added: chloramphenicol at 6 µg/ml, kanamycin (Km) at 50 µg/ml, and nalidixic acid (Nal) at 10 µg/ml. All Brucella strains used in this study were handled in biosafety laboratories (BSL3) at Leloir Institute (IIBBA-FIL) and Instituto de Investigaciones Biomédicas en Retrovirus y SIDA (INBIRS). Eukaryotic cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 5% fetal calf serum (Natocor), at 37°C in a 5% CO2 atmosphere.
3
Stmn2 Overexpression Construct Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the expression plasmid for Stmn2, the Kozak sequence (GCCACC), signal peptide sequence and coding sequence of mouse Stmn2 (https://www.uniprot.org/uniprot/P55821 ) were ligated into the NheI and ApaI restriction sites of pcDNA3.1(+) MAr. The construct was synthesized by GENEART GmbH, Life Technologies (GeneArt project 2018AAEGRC, Thermo Fisher Scientific). Then, Max Efficiency DH5α competent cells (Thermo Fisher Scientific, Cat# 18258012) were transformed according to the manufacturer's protocol. Plasmids were then extracted and purified using the PureLink HiPure Plasmid Maxiprep Kit (Thermo Fisher Scientific, Cat# K210006) for downstream experiments. Correct assembly of the final construct was verified by gene sequencing at the London Regional Genomics Facility, Western University. For Stmn2 overexpression studies, αTC1-6 cells were transiently transfected by pcDNA3.1 (+) MAr-stmn2 construct or empty vector (negative control). All transfections were done using Lipofectamine 2000 (Cat#11668-027, Invitrogen). To monitor normal cell growth and morphology, cells were checked daily by the EVOS cell imaging system (Thermo Fisher Scientific). The efficiency of transfection was determined at >70% through co-transfection with pEGFP.
4
Cloning and Construction of Speg and JPH2
5
Androgen Receptor and MECP2 Allele Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Androgen receptor (AR) assay was performed as previously described [10 (link)]. In brief, 400 ng of genomic DNA from iPSCs/ESCs was digested by CpG methylation-sensitive restriction enzymes HpaII and HhaI for 6 h. 2 μL of digestion was amplified using Platinum Taq DNA Polymerase High Fidelity (Invitrogen) with AR gene primers with a FAM label (Table S2 ). Male samples were used as a control to confirm complete digestion. Electrophoresis was performed by TCAG at The Hospital for Sick Children. Traces were analyzed using PeakScanner (Thermo Fisher Scientific). To identify which MECP2 allele was expressed on the active X chromosome, RNA was isolated from iPSCs and reverse transcribed into cDNA using SuperScript III (Invitrogen). Primers flanking the variant region (Table S2 ) were used for amplification with Platinum Taq DNA Polymerase High Fidelity or Q5 High Fidelity DNA Polymerase (New England BioLabs), followed by cloning as per the TOPO TA Cloning Kit (Invitrogen) or Zero Blunt TOPO Cloning Kit (Invitrogen) in OneShot TOP10 (Thermo Fisher Scientific) or Max Efficiency DH5α (Invitrogen) competent E. coli strains. 5–10 bacterial colonies per iPSC cell line tested were picked and grown in LB Medium (MP Biomedicals) for DNA extraction with Quick Plasmid MiniPrep Kit (Invitrogen). Samples were Sanger sequenced at TCAG and aligned to WT MECP2 template using benchling.com.
6
Plasmid Construction and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids of mHILPDA_sYFP2, mHILPDA_mCherry, and mATGL_mTurquoise2 were constructed by fusing the full-length cDNA into pEGFP-N2 (Clontech) and substituting the EGFP sequence by the sequence of the fluorescent proteins, mCherry, sYFP2, or mTurquoise2. Briefly, RNA from mouse white adipose tissue and liver was reverse transcribed with a First Strand cDNA synthesis kit (Thermo Fisher Scientific) and amplified with Phusion high-fidelity DNA polymerase (Thermo Fisher Scientific) using the primers mentioned in Table 1 . The PCR products were cloned into pEGFP-N2 vector using the XhoI and KpnI-HF (New England Biolabs) restriction sites. Afterwards, MAX Efficiency® DH5α™ competent cells (Invitrogen) were transformed by heat-shock and grown in Luria-Bertani agar plates with kanamycin. The vector was isolated using Qiagen plasmid maxi kit (Qiagen) according to the manufacturer’s instructions. The EGFP fragment was then excised from the pEGFP-N2 parent vector by enzyme digestion with KpnI-HF and NotI-HF. The vector was gel-purified with QIAquick gel extraction kit (Qiagen) and the fragments of mCherry, sYFP2, or mTurquoise2 (32 (link)) were ligated using T4 DNA ligase (Thermo Fisher Scientific) into the pEGFP-N2 vector, which was digested with KpnI and NotI. The resulting constructs used were mHILPDA fused to either mCherry or sYFP2 and mTurquoise2 fused to mATGL.
7
Cloning and Mutagenesis of Human CNT3
8
Cloning and Sequencing of Recombinant Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The synthesized length of the gene fragments was connected to the pJET 1.2 plasmids using the cloning system (Phu Sa Corp). The recombinant plasmid was inserted into Escherichia coli (MAX Efficiency DH5α (Life Technologies, Carlsbad, CA; chemically competent, ~109 colony-forming unit or CFU/μg pUC19)) on Luria-Bertani agar plates (Thermo Fisher Scientific, consisting of 10 g L−1 tryptone (peptone from casein), 5 g L−1 yeast extract, and 5 g L−1 sodium chloride) containing 100 μg/mL ampicillin. Five colonies on a pJET 1.2 plasmid were chosen for checking the transformation process by PCR with specific primers (pJET1.2, Phu Sa Corp; pJET1.2.Fw (5′-d(CGACTCACTATAGGGAGAGCGGC)-3′) and pJET1.2.Rv primers (5′-d(AAGAACATCGATTTTCCATGGCAG)-3′). The modified vector-carrying strains were grown on Luria-Bertani broth overnight and recovered with the FavorPrep Plasmid Extraction Mini Kit (Favorgen, Biotech Corp) according to the manufacturer's recommended procedures. The transformation results were confirmed by genetic sequencing with specific primers and plasmid pJET1.2 primers, using the Sanger sequencing technique on the Applied Biosystems 3130 device.
9
Bacterial Transformation Efficiency Comparison
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following commercial products were used: Max Efficiency DH5α (Life Technologies, Carlsbad, CA; chemically competent, ~109 colony-forming unit or CFU / μg pUC19), High Efficiency NEB 5-alpha (New England Biolabs, Ipswich, MA; chemically competent, CFU ~109/μg pUC19), and NEB 5-alpha Electrocompetent E. coli (New England Biolabs, CFU ~1010/μg pUC19).
10
Transformation of Nanoliter-Scale Assembly
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As the assembly reactions set up by Echo were at the nanoliter scale, it is
difficult to take out the assembled DNA using pipets and transform them into
bacterial competent cells. Instead, bacterial competent cells were added to each
well containing an assembled product. Competent Escherichia
coli (20 µL; MAX Efficiency DH5α, Life Technologies) was added to
each well of the reaction plate. The PCR plate was incubated on ice for 20 min
and then placed in a heat block at 42 °C for 45 s. The plate was placed back on
ice to incubate for 5 min, before adding 200 µL of room temperate super
Optimal Catabolite repression (SOC) medium to each well. The plate
was incubated at 37 °C with shaking at 200 rpm for 1 h. A multichannel pipet was
used to slowly drip 40 µL of each transformation mixture onto an omnitray
containing selective solid agar medium (LB—Kan). Alternatively, 100 µL of
transformation mixture was plated on individual petri dishes with selective
solid agar medium (Golden Gate assembly, LB—Kan; Gibson assembly, LB—Amp).
Plates were incubated overnight at 37 °C until single colonies appeared.
difficult to take out the assembled DNA using pipets and transform them into
bacterial competent cells. Instead, bacterial competent cells were added to each
well containing an assembled product. Competent Escherichia
coli (20 µL; MAX Efficiency DH5α, Life Technologies) was added to
each well of the reaction plate. The PCR plate was incubated on ice for 20 min
and then placed in a heat block at 42 °C for 45 s. The plate was placed back on
ice to incubate for 5 min, before adding 200 µL of room temperate super
Optimal Catabolite repression (SOC) medium to each well. The plate
was incubated at 37 °C with shaking at 200 rpm for 1 h. A multichannel pipet was
used to slowly drip 40 µL of each transformation mixture onto an omnitray
containing selective solid agar medium (LB—Kan). Alternatively, 100 µL of
transformation mixture was plated on individual petri dishes with selective
solid agar medium (Golden Gate assembly, LB—Kan; Gibson assembly, LB—Amp).
Plates were incubated overnight at 37 °C until single colonies appeared.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!