Acci restriction enzyme

PCR-RFLP genotyping for the two loci was performed as follows. The target region of the NUDT15 and TPMT genes was amplified by PCR using the primers PCP-0023/24 and PCP-0027/28 with the stepdown PCR protocol as described above. Each NUDT15 c.415C>T genotyping restriction digestion reaction contained 1.7 µL unpurified PCR product, 0.2 µL FastDigest Taal restriction enzyme (Thermo Fisher, Waltham, MA, USA), 0.3 µL 10× FastDigest Green Buffer (Thermo Fisher, Waltham, MA, USA) and nuclease-free water added up to 5 µL. Each TPMT*3C genotyping restriction digestion reaction contained 1.7 µL unpurified PCR product, 0.2 µL AccI restriction enzyme (New England Biolabs, Ipswich, MA, USA), 0.3 µL CutSmart Buffer (New England Biolabs, Ipswich, MA, USA) and nuclease-free water added up to 5 µL. The digestion mix was incubated either at 65 °C (for TaaI digestion) or 37 °C (for AccI digestion) for 15 min on a thermal block (Eppendorf, Hamburg, Germany), and separated alongside 2.0 µL of undigested PCR product using a 2% agarose gel in 1× TBE buffer by electrophoresis at 100 V for 45 min.

The SNPrs2274907 was genotyped by polymerase chain reaction on a GeneAmp PCR system 9700 thermal cycler (Applied Biosystems, Foster City, CA) using the primers, forward: 5ˈ CCTCTGCAGATCCAAAGGTG 3ˈ and reverse: 5ˈ CCGCACTGAGAATGGTGTTA 3ˈ. The PCR amplicons were digested with AccI restriction enzyme (New England Biolabs, Inc., Beverly, MA) and the resulting products were electrophoresed on a 3% agarose gel (S1 Fig). Based on the analysis of 200 blind duplicates (20%), there was 100% concordance in the genotyping. Furthermore, a few variants were confirmed by direct sequencing with an ABI 310 genetic analyzer (Foster City, CA). The SNP was in Hardy Weinberg equilibrium (HWE) (P = 0.59).