The largest database of trusted experimental protocols

4 protocols using taqman fast advanced 2 master mix

1

Centyrin-Mediated siRNA Delivery Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Centyrins were assessed for their ability to mediate uptake of siRNAs into various cell lines in the absence of transfection reagent. Cells were plated in 96-well plates (5,000–10,000 cells per well) for 24 h and then treated with Centyrin-siRNA conjugates in duplicate for 72 h. Cells were lysed with Protein Quant Sample Lysis Reagent (Applied Biosystems, Waltham, MA, USA). Lysates were frozen at −80°C until analysis. Samples were thawed on ice, and RNA in cell lysate was converted to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) in a ProFlex ThermoCycler (Thermo Scientific, Waltham, MA, USA) according to manufacturer’s instructions. qPCR of cDNA was performed using TaqMan Fast Advanced 2× Master Mix (Applied Biosystems) with TaqMan Gene Expression Assay Primer/Probes (Applied Biosystems) for CTNNb1 and peptidyl-prolyl cis-trans isomerase B (PPIB) on a ViiA 7 Real-Time PCR System (Applied Biosystems). Target gene CT values were normalized by subtracting the PPIB CT value to obtain a deltaCT. The average of untreated deltaCT values was then subtracted from the sample deltaCT. Relative mRNA level was then determined using the equation, % Gene expression = 100 × 2(−deltadeltaCT). Data were log transformed on the x axis, then analyzed using nonlinear regression, applying a 3-parameter model to determine IC50.
+ Open protocol
+ Expand
2

Quantitative PCR for Viral Load Measurement

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was isolated from the liver using QIAGEN DNeasy Blood & Tissue Kit. Viral load was measured by quantitative PCR (qPCR) using 75 ng DNA, nRBG (rabbit β-globin) primers, and a probe: forward TTCCCTCTGCCAAAAATTATGG; reverse CCTTTATTAGCCAGAAGTCAGATGCT; probe (6-FAM)-ACATCATGAAGCCCC-(MGBEcl-Q); the sequences were provided by Amicus Therapeutics. Viral load was normalized by the copy of GAPDH gene measured in each sample. The primers and a probe for GAPDH were as follows: forward GGCAAATTCAACGGCACAGT; reverse GGCCTCACCCCTTTGATTG; probe (6-FAM)-TCCAGGAGCGAGACCCCAC-(MGBEcl-Q). The qPCR was performed using TaqMan Fast Advanced 2× Master Mix (Applied Biosystems, 4444557). PCR conditions were 50°C for 2 minutes, 95°C for 10 minutes, and 40 cycles of 95°C for 15 seconds and 56°C for 20 seconds.
+ Open protocol
+ Expand
3

Urine miRNA Expression Assessment

Check if the same lab product or an alternative is used in the 5 most similar protocols
For miRNA expression assessment in the complete cohort (n = 49), miRNAs were extracted from urine samples collected at baseline and on D5, using the miRNeasy Serum/Plasma Kit (Qiagen, Germany), following the manufacturer’s instructions. During extraction procedures, 3 × 107 copies of the synthetic miRNA Caenorhabditis elegans miR-39 (cel-miR-39) were added to be used as an exogenous control (spike-in). cDNA was synthesized using the TaqMan™ Advanced miRNA cDNA Synthesis Kit (Applied Biosystems, Waltham, MA, USA), following the manufacturer’s instructions.
RT-qPCR reactions were performed on a Rotor-Gene Q (Qiagen, Germany), using TaqMan™ Advanced miRNA Assays (Applied Biosystems, Waltham, MA, USA) for the miRNAs selected as possible endogenous normalizers, as well as for cel-miR-39 (spike-in) [28 (link)]. The total reaction volume was reduced to 10 µL, consisting of 5 µL of TaqMan® Fast Advanced Master Mix (2×) (Applied Biosystems, USA), 0.5 µL of TaqMan® Advanced miRNA Assay (20×) (Applied Biosystems, USA), 2 µL of RNase-free water, and 2.5 µL of diluted cDNA (1:10). Raw data were evaluated using Rotor-Gene Q Series Software 2.1.0.9 (Qiagen, Germany).
As part of the quality control, samples whose cel-miR-39 expression was above two standard deviations were excluded from the analysis.
+ Open protocol
+ Expand
4

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Using total cDNA from the previous section, six samples (two per genotype) were examined in triplicate wells on a 96-well plate to compare transcript levels for a gene of interest to GAPDH transcript expression. A TaqMan assay for each of the six genes of interest (Table 1) was performed on its own plate. In each well, 2 μL of cDNA were added to a mix of 10 μL TaqMan Fast Advanced Master Mix (2×) (Applied Biosystems; Austin, TX, USA), 1 μL custom TaqMan Assay (20×) (Applied Biosystems; Pleasanton, CA, USA), and 7 μL of nuclease-free water. Each plate was placed in a Benchmark Scientific TC9639 Thermal Cycler and run on a program of 2 min at 50 °C, 20 s at 95 °C, and then 40 cycles of 1 s at 95 °C and 20 s at 60 °C.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!