32p datp

DNA was transferred from pulsed-field gels onto Hybond N+ membrane (GE Healthcare, Little Chalfont, UK) with 20× SSPE (3M NaCl, 20 mM EDTA, 154.8 mM Na₂HPO₄, 45.2 mM H₆NaO₆P, pH 7.4). The pMBR2 vector (NCBI: AF451863) carrying an 8.5 Kb fragment of the conserved internal region of Tlr elements (Wuitschick et al., 2002 (link)) was a gift from Dr Kathleen Karrer (Marquette University, USA). The Tlr sequence was excised from the vector with BamHI plus PstI (New England BioLabs) digestion, gel isolated, radioactively labeled by random priming using ³²P-dATP (Hartmann Analytic, Braunschweig, Germany), and hybridized to germline DNA on the membrane. The signal was detected using Imaging Screen K (Bio-Rad) and scanned with a Typhoon 9200 image analyzer (GE Healthcare).

Genomic DNA samples (5 µg) digested with BamHI and XhoI (New England BioLabs) were electrophoresed through an 0.8% agarose gel and then transferred by capillary action onto a Hybond-nylon membrane (GE Healthcare, Little Chalfont, UK) with 20× SSPE (3 M NaCl, 20 mM EDTA, 154.8 mM Na₂HPO₄, and 45.2 mM H₆NaO₆P; pH 7.4). For the probe, a 579-bp PCR product was amplified from B2086.2 wild-type genomic DNA with the following primers: forward, GAGCTGAATGAATGAATGAATGAAT and reverse, AATTTTATTACCCCACAAATCAATC. The probe was radioactively labeled by random priming with ³²P-dATP (Hartmann Analytic, Braunschweig, Germany) and hybridized to the DNA on the membrane. The signal was detected with an imaging plate (FUJIFILM Corporation, Tokyo, Japan) and scanned with a Typhoon 9200 image analyzer (GE Healthcare). Band intensity (a rough estimation of the degree of MAC assortment) was measured using ImageJ software.