Goat anti hamster igg h l

PLAT-E cells (Cell BioLabs) were transfected with empty vector (EV), overexpression vectors (Eomes, Bcl2, Tgfbr2), non-targeting shRNA construct, or shRNA constructs targeting P2rx7 (Transomic) with TransIT-LT1 Reagent (Mirus). The Eomes vector was provided by Dr. Steven Reiner, Columbia University; the Bcl2 vector was provided by Dr. Michael Croft, La Jolla Institute for Immunology; and the Tgfbr2 vector was provided by Dr. Wanjun Chen, National Institutes of Health. Retroviral supernatants were harvested 48h and 72h post-transfection. CD8⁺ T cells were isolated using the CD8⁺ T cell isolation kit (Miltenyi) and activated with plates coated with 100 μg/mL of goat anti-hamster IgG (H+L, Thermo Fisher Scientific), 10 μg/mL of anti-CD3 (3C11, BioXCell), and 10 μg/mL of anti-CD28 (37.51, BioXCell). After 18–22 hours of activation, the cells were ‘spinfected’ with retroviral supernatant supplemented with 8 g/mL of polybrene (Millipore) at 900g for 90 min at room temperature. The retroviral supernatant was replaced by culture media and the cells were incubated at 37°C. Transduction efficiency was measured based on ametrine or GFP signal using flow cytometry at 24h and 48h post-transduction.

shRNA’s targeting CTCF were produced by cloning shRNAmir sequences (CTCF#1: CCAGATGAAGACTGAAGTCAT; CTCF#2: GCAGAGCATTCAGAACAGTGA into our pLMPd-Amt vector ^{79 (link)}. For transfections, 3×10⁶ PLAT-E cells were seeded in a 10 cm dish 1 day before transfection. Each plate was transfected 10 μg of DNA from each pLMPd-Amt clone and 5 μg of pCL-Eco using TransIT-LT1 (Mirus) in Opti-MEM medium. The medium was replaced by T cell medium after 16h and the retroviral supernatant were collected 48 hours later.
For CD8⁺ T cell activation, naive CD8⁺ T cells from spleens and lymph nodes were negatively enriched with MACS columns using biotin anti-CD4, anti-Ter119, anti-GR-1, anti-MHCII, anti-B220, and anti-NK1.1. 2 × 10⁶ OT-I or P14 cells were plated in a well of a 6-well plate that was pre-coated with 100 μg/ml goat anti-hamster IgG (H+L, Thermo Fisher Scientific). The activation medium contained 1 μg/ml anti-CD3 (145–2C11) and 1 μg/ml anti-CD28 (37.51) (eBioscience). Culture medium was replaced after 18h of activation with retroviral supernatant mixed with 50 μM BME and 8 μg/ml polybrene (Millipore) followed by spin-infection (1-hour centrifugation at 2000 RPM, 37°C). The plate was incubated at 37°C for 3 hours after spin-infection, and then the retroviral supernatant was replaced by T cell medium and incubated for 24 hours.