Probes were synthesized by T7 RNA Polymerase (Roche,10881767001) or SP6 RNA Polymerase (Roche, 0810274001) and labeled by Digoxigenin RNA labeling mix (Roche, 11277073910). Fluorescence in situ hybridization was performed as previously described.113 (link) In summary, hearts were removed and fixed overnight at 4°C in 4% paraformaldehyde. These hearts were then hybridized with probes in a hybridization buffer, followed by blocking and then incubation with anti-Digoxigenin-POD fab fragments (Roche, 11207733910) in a blocking buffer. The mRNA was detected using TSA Plus Cyanine 5 Kit (AKOYA BIOSCIENCES, NEL745001KT) according to the manufacturer’s instructions. Next, the hearts were processed with a standard antibody staining protocol for immunofluorescence. The primers for generating cxcr4b antisense mRNA are as follows: Forward = CAACAGCTCTGACTCCGGTT; Reverse = GCAGTGGAAATATGCCAGCG. The primers for generating csf1a antisense mRNA are as follows: Forward = ACAGCTGGCTTACTGCAACA; Reverse = AGCATGAGCGGCTCCTTTATT. The primers for generating ptx3a antisense mRNA are as follows: Forward = CTGATCGGTACGAGCAGCAT; Reverse = CCACGGATACCACAAGCAGT. The primers for generating mrc1b antisense mRNA are as follows: Forward = AATGAGAGTGTCGCTGTGGG; Reverse = GCGACGATTTGCCTCAATCC.
Tsa plus cyanine 5 kit
Manufactured by Akoya Biosciences
The TSA Plus Cyanine 5 Kit is a laboratory product offered by Akoya Biosciences. It is a reagent kit designed for the amplification and detection of target biomolecules, such as proteins or nucleic acids, using a tyramide signal amplification (TSA) method with Cyanine 5 labeling.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using tsa plus cyanine 5 kit
1
Fluorescence In Situ Hybridization and Immunofluorescence of Zebrafish Hearts
2
Fluorescence In Situ Hybridization of Cardiac Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Probes were synthesized by T7 RNA Polymerase (Roche,10881767001) and SP6 RNA Polymerase (Roche, 0810274001) and labeled by Digoxigenin RNA labeling mix (Roche, 11277073910). Fluorescence in situ hybridization was performed as previously described101 (link). In summary, hearts were removed and fixed overnight at 4 °C in 4% paraformaldehyde. After processing, these hearts were cryosectioned to obtain 10 μm sections and then hybridized with probes in hybridization buffer, followed by blocking and then incubation with anti-Digoxigenin-POD fab fragments (Roche, 11207733910) in blocking buffer. The mRNA was detected using a TSA Plus Cyanine 5 Kit (AKOYA BIOSCIENCES, NEL745001KT) according to the manufacturer’s instructions. Next, the sections were processed with standard antibody staining protocols for immunofluorescence as described7 (link) and then imaged. The primers for generating antisense mRNA are as follows: serpine1 Forward = TTGGGCTACAGGTGTTTGCT and Reverse = GCCGGTCAAGTGTGATTTCC; vegfaa Forward = ATGAACTTGGTTGTTTATTTGAT and Reverse = TCATCTTGGCTTTTCACATC; cxcr12a Forward = CGCCATTCATGCACCGATTT and Reverse = TGACCTGATTCTGCTGAGCG; ccbe1 Forward = TACCCGTGCGTAAAGTCCAC and Reverse = ACAGTCTCAAACCGGCCAAT; tgfb1a Forward = TGCTTGCTGGACAGTTTGGT and Reverse = GTGCCAACAGCTCGTCTCTT; and cpn1.1 Forward = AAATGAGGTGCTCGGAAGGG and Reverse = TTTTAGCCGTCGATAGGCCC.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!