Genes encoding HyaA and HyaB were amplified from the E. coli BL21(DE3) genome via using CloneAmp HiFi polymerase (Takara, Japan) (Table S1, ESI† ). The C-terminus of full-length CsoS2 served as an encapsulation peptide (EP) and was amplified from the pHnCBS1D plasmid (Addgene, US). The EP sequence was fused to the 3′-end of hyaB followed by ligation to the pCDFDuet-1 vector linearized by EcoRI and HindIII to produce the pCDF-hyaB-EP vector. The hyaA gene with the C-terminus fused with the CsoS2 C-terminus was ligated to the pCDF-hyaB-EP vector linearized by NdeI and XhoI to generate pCDF-hyaAB-EP. The resulting PCR products and linearized vectors were purified by using a DNA gel extraction kit (New England BioLabs, UK) following the standard manufacture protocol. All vectors were verified by PCR and DNA sequencing (IDT, US) and transformed into E. coli BL21(DE3) competent cells.
Dna gel extraction kit
Manufactured by New England Biolabs
Sourced in United Kingdom, United States
The DNA gel extraction kit is a laboratory tool used to purify DNA fragments from agarose gel electrophoresis. It is designed to efficiently extract and recover DNA of interest from the gel matrix.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using dna gel extraction kit
1
Construction of Hybrid Hydrogenase Enzyme
2
PCR Amplification and DNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bands resulting from the PCR amplification were excised from the gel, and the DNA was extracted with the DNA Gel Extraction kit (Monarch, New England BioLabs, Ipswich, MA, USA), following the manufacturer’s instructions. After extraction, the purified DNA was sent for sequencing at GATC Biotech. Sequence identity was determined by a BLAST search of the National Center for Biotechnology Information (NCBI) database.
3
Bacterial Strain and Plasmid Preparation for Molecular Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bacterial strains and plasmids used in this study are listed in Tables S1 and S2 , respectively. PCR was performed by KOD Hot Start DNA polymerase (National England BioLabs/NEB) or Q5 High-Fidelity 2× Master Mix (NEB) for cloning purposes according to the manufacturer’s instructions. Plasmid DNA and PCR fragments were purified using the plasmid miniprep kit (NEB) and DNA gel extraction kit (NEB). E. coli K12 chromosomal DNA was used as the template. E. coli DH5α stain was used for cloning, and E. coli BL21 (DE3) was used for recombinant protein purification. E. coli MG1655 strain and KO mutants were used for growth curve measurement, PG composition analysis, immunoblotting, and MIC study.
Unless otherwise specified, bacteria were cultured in LB [1% tryptone, 0.5% yeast extract, 0.5% NaCl] or LB-salt–free [1% tryptone, 0.5% yeast extract] medium at 37 °C. Agar 1.5% (w/v) was used in solid plates. Antibiotics were used at the following concentrations (per mL): 30 (chloramphenicol; Cm30), 50 (kanamycin; Kan50), or 100 (ampicillin; Amp100) where appropriate.
Unless otherwise specified, bacteria were cultured in LB [1% tryptone, 0.5% yeast extract, 0.5% NaCl] or LB-salt–free [1% tryptone, 0.5% yeast extract] medium at 37 °C. Agar 1.5% (w/v) was used in solid plates. Antibiotics were used at the following concentrations (per mL): 30 (chloramphenicol; Cm30), 50 (kanamycin; Kan50), or 100 (ampicillin; Amp100) where appropriate.
4
Frataxin Expression Plasmid Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pcDNA3.1‐hFrataxin‐HA plasmid (31895) was obtained from Addgene. The following primers (forward) 5′‐GCTCGCTAGCGCCACCATGTGGACTCTCGGGCG‐3′ and (reverse) 5′‐GCCCGGATCCTCAAGCATCTTTTCCGGAATAGGCC‐3′ were synthesized (Sigma‐Aldrich) and used to generate a frataxin‐containing PCR product (without Human influenza hemagglutinin [HA]‐tag) flanked by NHEI (5′ end) and BAMHI (3′ end) restrictive sites. This PCR product was digested with restriction endonucleases NHEI and BAMHI and gel purified with the DNA Gel Extraction Kit (T1020S, NEB). The Lentiviral NanoLuc control expression vector plasmid (113450, Addgene) was obtained from Addgene and gel purified using the Monarch® DNA Gel Extraction Kit (T1020S, NEB) after being digested with restriction endonucleases NHEI and BAMHI to remove both the NanoLuc insert and the amino‐terminal MYC epitope tag. T4 ligase was used to conjugate the gel‐purified insert into the gel‐purified backbone of the plasmid (Figure 3a ). Final expression plasmids were verified by Sanger Sequencing (Eurofins Genomics).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!