Rnasecure reagent

Each colony was separately grounded in liquid nitrogen in 50-ml stainless steel bowls with 20-mm-diameter grinding balls (Retsch MM400 mill). RNA extraction was achieved from 200 mg of powdered corals mixed with 1 ml of Trizol reagent (Invitrogen). After precipitation with the high salt solution protocol, RNA pellet was resuspended in 40 μl of RNAsecure reagent (Ambion) and RNase were heat-inactivated by an incubation at 65°C for 10 min. RNA concentration and purity were checked using a Nanodrop ND-1000 spectrometer (Thermo Scientific). The appropriate amount of RNA was next treated with the TURBO DNase kit (Ambion). Total RNAs was cleaned using the RNeasy Power Clean Pro Cleanup kit (Qiagen). RNA integrity and quantification were analyzed by capillary electrophoresis on a BioAnalyzer 2100 (Agilent). DNA was extracted from an aliquot of the powdered corals using a DNAeasy Blood and Tissue kit (Qiagen) and was quantified by spectrophotometry (NanoDrop). All protocols followed the manufacturers’ instructions.

Total RNA was isolated from frozen fry using a modified trizol/chloroform protocol described previously36 . RNA was extracted using Trizol Reagent (Invitrogen). Total RNA was treated for 10 min at 65 °C with RNAsecure reagent (Ambion) and for 10 min at 37 °C with RNase-free TURBO DNase (Ambion). Total RNA was further purified using RNAeasy Mini Kit (Qiagen) according to the manufacturer's protocol. Concentration, integrity and extent of contamination by ribosomal RNA were assessed using Qubit Fluorometer (Life Technologies) and Bioanalyzer 2100 (Agilent Technologies). Preparation of cDNA for Illumina Genome Analyzer 2500 was completed following the TruSeq RNA Sample Preparation Kit v2 protocol (Illumina). Each individual had a unique barcode and barcodes were assigned evenly across sample type. Individuals were randomly allocated across lanes, and each lane had 10–12 individuals. This procedure resulted in an average of 20 million 100-bp single-end reads for each individual, with a total of 1.8 billion reads across the entire study.

Total RNA was isolated using the TRI-Reagent isolation kit (Ambion) as per the manufacturer's protocol. The RNA pellets were dissolved in 1 mM sodium citrate buffer pH 6.5, containing 1× RNA Secure Reagent (Ambion). The RNA concentration was measured using UV spectrophotometry. The RNA samples were treated with RNase-free DNase (Promega, USA) according to the manufacturer's instructions. Then the samples were subjected to repeated RNA extraction with a phenol-chloroform mixture and pure chloroform followed by precipitation with propanol. Reverse transcription was performed using the cDNA synthesis MMLV RT kit (Evrogen, Russia) according to the manufacturer's protocol.

Yeast-tRNA (Roche 10109525001), RNase inhibitor (Promega N251A), RNaseZap (Invitrogen AM9780), TRIzol Reagent (Invitrogen 15596018), 3 M Sodium Acetate pH5.5 (Invitrogen AM9740), Perfect Start Green qPCR SuperMix (TransGene AQ601-04), RNeasy RNA purification Kit (Qiagen 74104), mRNA Capture Beads (Vazyme N401), Qubit RNA Assay Kit (Qubit Q32852), RNA secure Reagent (Ambion AM7006), Turbo DNase (Invitrogen AM2238), riboPOOLs (rRNA removal probes) (siTOOLs Biotech), Streptavidin magpoly beads (SMART lifesciences SM01710), Low Melting Point Agarose (Invitrogen 16520-050), 10 × TBE Buffer (Invitrogen 15581-044), DNA size Marker (DL1000, Takara 3591Q), NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB E7760).

Mantle tissue samples were individually ground in liquid nitrogen in a Retsh^® MM400 grinder (grinding speed = 30 oscillations/sec for 20 s) (Retsh, Haan, Germany). RNA extraction was performed using TRIZOL^® Reagent (Life Technologies™, Carlsbad, CA, USA) according to the manufacturer’s recommendations. After RNA precipitation, the pellets were suspended in RNA secure reagent^® (ThermoFisher Scientific, Waltham, MA, USA) and heated to 65 °C for 10 min to inactivate the RNase. DNA contamination was removed with the DNA-free kit (Ambion^® RNA Life Technologies™, Carlsbad, CA, USA) according to the manufacturer’s instructions. Finally, RNAs were cleaned with the PureLink™ RNA Mini Kit (Ambion^® RNA Life Technologies™™, Carlsbad, CA, USA) according to the manufacturer’s protocol. RNA quality and quantity were verified with a NanoDrop 1000© and an Agilent 2100 Bioanalyzer^® (Agilent Technologies™, Santa Clara, CA, USA). RNA sequencing libraries were produced using the Truseq3 kit. Sequencing was performed on an Illumina^® HiSeq^® 4000 (Illumina, San Diego, CA, USA), with 100 bp stranded paired-end reads. Library construction and sequencing were done by Génome Québec (Montreal, Québec, QC, Canada) (MPS Canada).

Total RNA was extracted from cells using Tri Reagent (Sigma, Lt. Louis, Missouri, MO, USA) and purified with RNeasy (Qiagen, Germantown, Maryland, MD, USA) into nuclease-free water containing RNAsecure Reagent (Thermo Fisher Scientific, Waltham, MA, USA).
Reverse transcriptase and PCR were conducted in one reaction with the reverse PCR primer priming cDNA synthesis, as we previously described [67 (link)]. Primer–probe sequences for UCP1, GLUT4, ATGL, adiponectin, and ribosomal RPL13A are provided in our previously published study [68 (link)]. RPL13A was used to normalize for total RNA in each sample. Additional primer and probe oligonucleotide sets used in this study are: TRPM8, shown in a 5′ to 3′ orientation, forward GAGACACCAAGAACTGGAAGAT reverse AGGTGAAGAACGCCACATAG probe TTGGTGGGCTGTGGCTTTGTATCA; predesigned human primer and probe sets from Thermofisher Scientific are ADRB1 Hs02330048_s1 and PRKAR2B Hs01036963_m1.