Total RNA (10 ng) was amplified to cDNA using random priming with the Ovation® RNA-Seq System (NuGEN). This procedure involved initial generation of double-stranded cDNA followed by amplification through production of single-stranded cDNA using the SPIA® process. The single-stranded cDNA was then copied into double-stranded cDNA and quantified using the PicoGreen kit (Invitrogen) assayed with the FUSION system (Packard Biosciences), resulting in a total yield of 3–4 ug amplified cDNA’s. Standard concentration curves using bacteriophage lambda DNA were generated for each PicoGreen analysis, and the samples were diluted by 10-fold serial dilutions. QC of the amplified cDNA was determined using a Bioanalyzer running an RNA 6000 Nano LabChip (Agilent). Double-stranded cDNA (1–2 ug) was fragmented to 150–200 bp sizes using Adaptive Focused Acoustics™ (Covaris, Inc., Woburn, MA), and QC of the fragmented cDNA was performed using a Bioanalyzer DNA Chip 1000 (Agilent). Fragmented cDNA’s were concentrated using the QIAquick PCR Purification Kit (Qiagen) and 200 ng of the fragmented cDNA’s (determined following PicoGreen quantitation) were end-repaired, followed by adaptor ligation onto the fragments and amplification using the Encore® NGS Library System I (NuGEN). Library QC was performed using a Bioanalyzer DNA Chip 1000.
Bioanalyzer dna 1000 chip
Manufactured by Agilent Technologies
Sourced in United States
The Bioanalyzer DNA 1000 chip is a lab equipment product from Agilent Technologies. It is designed for the analysis of DNA samples with fragment sizes ranging from 25 to 1,000 base pairs. The chip utilizes microfluidic technology to separate and detect DNA fragments, providing accurate size and concentration measurements.
Automatically generated - may contain errors
Lab products found in correlation
Nextera xt index kit, by Illumina (11 mentions)
Ampure xp bead, by Beckman Coulter (10 mentions)
Miseq platform, by Illumina (9 mentions)
Miseq reagent kit v3, by Illumina (8 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (6 mentions)
Miseq system, by Illumina (6 mentions)
Miseq reagent kit v2, by Illumina (5 mentions)
Truseq rna sample prep kit, by Illumina (5 mentions)
Hiseq 4000, by Illumina (5 mentions)
Hiseq 2000, by Illumina (4 mentions)
Nextera xt indices, by Illumina (4 mentions)
Agencourt ampure xp bead, by Beckman Coulter (3 mentions)
Nextseq, by Illumina (3 mentions)
Trueseq stranded mrna kit with polya selection, by Illumina (3 mentions)
Ampure spri beads, by Beckman Coulter (3 mentions)
Hiseq 2000 platform, by Illumina (3 mentions)
16s metagenomic sequencing library preparation guide, by Illumina (3 mentions)
Encore ngs library system 1, by Tecan (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Rna 6000 nano labchip, by Agilent Technologies (2 mentions)
78 protocols using bioanalyzer dna 1000 chip
1
RNA-Seq Library Preparation Protocol
2
Amplification and Fragmentation of Total RNA for NGS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (10 ng) was amplified to cDNA using random priming with the Ovation® RNA-Seq System (NuGEN). This procedure involved initial generation of double-stranded cDNA followed by amplification through production of single-stranded cDNA using the SPIA® process. The single-stranded cDNA was then copied into double-stranded cDNA and quantified using the PicoGreen kit (Invitrogen) assayed with the FUSION system (Packard Biosciences), resulting in a total yield of 3–4 ug amplified cDNA’s. Standard concentration curves using bacteriophage lambda DNA were generated for each PicoGreen analysis, and the samples were diluted by tenfold serial dilutions. QC of the amplified cDNA was determined using a Bioanalyzer running an RNA 6000 Nano LabChip (Agilent). Double-stranded cDNA (1–2 μg) was fragmented to 150–200 bp sizes using Adaptive Focused Acoustics™ (Covaris, Inc., Woburn, MA), and QC of the fragmented cDNA was performed using a Bioanalyzer DNA Chip 1000 (Agilent). Fragmented cDNA’s were concentrated using the QIAquick PCR Purification Kit (Qiagen) and 200 ng of the fragmented cDNA’s (determined following PicoGreen quantitation) were end-repaired, followed by adaptor ligation onto the fragments and amplification using the Encore® NGS Library System I (NuGEN). Library QC was performed using a Bioanalyzer DNA Chip 1000.
3
Fecal DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 0.18–0.22 g of feces content of each sample with the DNeasy® PowerLyzer® PowerSoil® isolation kit (Qiagen) according to the manufacturer’s recommendations. The concentration of the extracted DNA was determined by fluorometric Quantification (Qubit 2.0 Fluorometer, Thermo Fisher Scientific) and stored at − 20 °C until use. Library preparation was preformed using the Nextera XT DNA Library Preparation Kit (Illumina, Int., San Diego, CA, USA) according to the manufacturer’s recommendation, by the DTU in-house facility (DTU Multi-Assay Core (DMAC), Technical University of Denmark). Size confirmation of the target was performed on a Bioanalyzer DNA 1000 chip (Agilent Technology, CA), and the DNA concentration was determined with Qubit 2.0 Fluorometer. DNA libraries were mixed in equimolar ratios. Sequencing was performed as a 150-bp paired-end run on HiSeq 3000/4000 (Illumina Int., San Diego, CA USA) at Novogene Europe’s facility following the manufacturer’s recommendations.
4
Sequencing Transposon Insertion Locations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used a previously described protocol for mapping the transposon insertion locations and to link these mutants to their unique DNA barcode sequences (16 (link)). Full details describing this protocol are available (16 (link)). Briefly, genomic DNA was extracted using the Qiagen DNeasy blood and tissue kit, with RNase A treatment, according to the manufacturer’s recommendations. The DNA was sheared to ∼300 bp using a Covaris S220, and the DNA was repaired and A-tailed using the NEBNext DNA Library preparation kit for Illumina (New England Biolabs). After ligating Illumina compatible adapters to the DNA fragments, we PCR amplified the transposon insertion junctions using primers with Illumina P5 and P7 sequences. The final PCR product was purified using AMPure XP beads and assessed for quantity and size using an Agilent Bioanalyzer DNA1000 chip. Samples were sequenced on a HiSeq2500 instrument at the QB3 Berkeley Genomics Center using 2 × 150 reads. TnSeq reads were analyzed with a custom Perl script, MapTnSeq.pl, which assigns each unique barcode sequence to a corresponding location in the genome. Each barcode was mapped to a single insertion site by identifying barcodes that consistently map to a unique location in the genome using DesignRandomPool.pl. All scripts used are available at https://bitbucket.org/berkeleylab/feba/src/master/bin/ (16 (link), 62 (link)).
5
Fungal ITS1 Amplicon Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We prepared amplicon libraries, targeting the ITS1 region, using ITS1F and ITS2 primers (35 (link), 36 (link)). Amplicon were generated by PCR using a 96-well thermal cycler in the following conditions: 95°C for 3 min, 25 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, and 72°C for 5 min, and cooling at 4°C. Amplicons were purified with AMPure XP (Beckman Coulter, USA) as described in the 16S Metagenomic Sequencing Library Preparation guide (37 ). Adapter were attached using Nextera XT Index Kit (Illumina, France) and the index PCRs were performed in the following conditions: 95°C for 3 min, eight cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, and 72°C for 5 min, and cooling at 4°C. Barcoded PCR products were purified with AMPure XP (Beckman Coulter, USA) and verified and quantified on a Bioanalyzer DNA 1000 chip (Agilent, USA). Samples were normalized at 4 nM and pooled into a library, using 5 μL of each diluted sample. A PhiX sequencing control was prepared following the manufacturer’s instructions. The libraries were sequenced in 300-bp paired-end using the MiSeq reagent kit V3 on Illumina MiSeq platform (Illumina, Evry, France).
6
Whole-Genome Bisulfite Sequencing Library Prep
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-genome sequencing libraries were generated from 700 to 1000 ng of genomic DNA spiked with 0.1% (w/w) unmethylated λ DNA (Promega) previously fragmented to 300–400 bp peak sizes using the Covaris focused-ultrasonicator E210. Fragment size was controlled on a Bioanalyzer DNA 1000 Chip (Agilent) and the KAPA High Throughput Library Preparation Kit (KAPA Biosystems) was applied. End repair of the generated dsDNA with 3′ or 5′ overhangs, adenylation of 3′ ends, adaptor ligation, and clean-up steps were carried out as per KAPA Biosystems’ recommendations. The cleaned-up ligation product was then analyzed on a Bioanalyzer High Sensitivity DNA Chip (Agilent) and quantified by PicoGreen (Life Technologies). Samples were then bisulfite converted using the Epitect Fast DNA Bisulfite Kit (Qiagen) according to the manufacturer’s protocol. Bisulfite-converted DNA was quantified using OliGreen (Life Technologies) and, based on quantity, amplified by 9–12 cycles of PCR using the Kapa Hifi Uracil + DNA polymerase (KAPA Biosystems) according to the manufacturer’s protocol. The amplified libraries were purified using Ampure XP Beads (Beckman Coulter), validated on Bioanalyzer High Sensitivity DNA Chips, and quantified by PicoGreen.
Sequencing of the WGBS libraries was performed on the Illumina HiSeq2500/HiSeqX system using 125 or 150-bp paired-end sequencing.
Sequencing of the WGBS libraries was performed on the Illumina HiSeq2500/HiSeqX system using 125 or 150-bp paired-end sequencing.
7
16S rRNA Gene Amplicon Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sample preparation for sequencing of the hypervariable V3-V4 regions of the 16S rRNA gene was performed according to the modified protocol by Illumina50 . Amplification of the 16S rRNA gene fragment (primers 341F 5′-CCTACGGGNGGCWGCAG-3′ and 785Rev 5′-GACTACHVGGGTATCTAATCC-3′) and barcoding primers from Kozich et al.51 (link) were performed in a single reaction. The PCR reaction comprised of 1 ng/μL template, 1X Phusion High-Fidelity PCR Master Mix (Thermo Scientific, Waltham, MA, USA), 0.25 μM V3-V4 locus specific primers and 0.375 μM dual-index primers. The PCR was run under the following settings: 98 °C for 30 s, 27 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s and finally 10 min at 72 °C. The PCR clean-up was performed with AMPure XP beads (Beckman Coulter, Copenhagen, Denmark) and confirmation of the right size of the target (ca. 640 base pairs including adapters) was performed on a Bioanalyzer DNA 1000 chip (Agilent Technology, Santa Clara, CA, USA). The pooled libraries were sequenced at the sequencing unit of the Institute for Molecular Medicine Finland (FIMM), Helsinki, Finland with an Illumina HiSeq 2500 sequencer using HiSeq Rapid SBS Kit v2 (2 × 250 bases).
8
RNA-Seq Library Preparation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lung derived RNA samples were treated with RiboZero H/M/R rRNA (Illumina, San Diego, CA) depletion mix following a 40μl total volume; 4μL reaction buffer, 8μL probes, and 28μL sample. All incubation times followed the Ribo-Zero manual. After Ampure RNACleanXP (Beckman Coulter, Brea, CA) purification, the enriched RNA was eluted in 6μL of water. Following the Truseq Stranded mRNA Library Preparation Guide, Revision E., (Illumina, San Diego, CA), 5μL was added to 13μL of Elute-Frag-Prime Buffer and continued through second-strand cDNA. Library preparation continued with the adenylation of ends following the manufacturer’s recommendations. Final libraries were visualized on a BioAnalyzer DNA1000 chip (Agilent Technologies, Santa Clara, CA) and quantified using KAPA Library Quant Kit (Illumina) Universal qPCR Mix (Kapa Biosystems, Wilmington, MA) on a CFX96 Real-Time System (BioRad, Hercules, CA). Libraries were diluted to 2 nM stock, pooled together in equimolar concentrations and sequenced on an Illumina MiSeq using a Micro v2 sequencing kit at 2 × 150-bp. These data were used to make a new 2 nM pool so that virus coverage was normalized across samples. Subsequent sequencing was performed on an Illumina NextSeq 550 using a Mid Output v2.5 sequencing kit at 2 × 150-bp. Viral genome read depth coverage was greater than 100× for all samples.
9
Bovine Gut Microbiome Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fecal swabs were collected from fecal material obtained via rectal palpation from each calf and immediately transported to the lab and stored at −20 °C, where swabs were resuspended in 500 μL of PBS and stored at −80 °C. Genomic DNA extraction was performed with a Nucleospin Blood kit (Machinery Nagel, GmbH & Co., Düren, Germany) following the manufacturer’s protocol, and the DNA quantity and quality were assessed with BioDrop DUO (BioDrop Ltd., Cambridge, UK).
A 16S rRNA gene library was prepared from the total extracted DNA and sequenced at Servei de Genòmica, Universitat Autònoma de Barcelona, (Illumina pair-end 2X250 bp, MS-102-2003 MiSeq Re-agent Kit v2, 500 cycle). The size of the amplicons was verified on a Bioanalyzer DNA 1000 chip (Agilent), as expected amplicon lengths using Illumina recommended primers were around 460 bp. Finally, the sequences corresponding to variable regions V3-V4 of the 16S rRNA gene were sorted into samples and used as input for bioinformatic analysis.
A 16S rRNA gene library was prepared from the total extracted DNA and sequenced at Servei de Genòmica, Universitat Autònoma de Barcelona, (Illumina pair-end 2X250 bp, MS-102-2003 MiSeq Re-agent Kit v2, 500 cycle). The size of the amplicons was verified on a Bioanalyzer DNA 1000 chip (Agilent), as expected amplicon lengths using Illumina recommended primers were around 460 bp. Finally, the sequences corresponding to variable regions V3-V4 of the 16S rRNA gene were sorted into samples and used as input for bioinformatic analysis.
10
16S rRNA Gene Sequencing from Fecal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 2 ml fecal sample using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. DNA yield was quantified using the Invitrogen Qubit 4 fluorometer (Thermo Fisher Scientific, Waltham, MA, United States). Sequencing libraries of the V3–V4 region were prepared according to the Illumina MiSeq system instructions (F:5′TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCT ACGGGNGGCWGCAG3′; R:5′GTCTCGTGGGCTCGGAGATG TGTATAAGAGACAGGACTACHVGGGTATCTAATCC3′). In brief, the V3 and V4 regions of the 16S bacterial rRNA gene were amplified using a two-step polymerase chain reaction (PCR) protocol with V3 and V4 region primers for the first PCR and Nextera XT index primers for the second PCR. Amplicons were cleaned using AMPure XP magnetic beads, and then, Illumina sequencing adapters and dual-index barcodes were added to each amplicon. The library concentrations were assessed with a Qubit dsDNA assay kit (Thermo Fisher Scientific, Waltham, MA, United States). The quality of the library was checked by running 1 μl on a Bioanalyzer DNA1000 chip (Agilent, Santa Clara, CA, United States) to verify the amplification and peak sizes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!