DNA is purified by use of DNA Purification Kit (Macherey-Nagel, Duren, Germany) according to manufacturer’s instructions. DNA concentration is measured using Qubit® 2.0 Fluorometer (Life Technology, Carlsbad, CA, USA) and normalized to 5 ng/μl for amplicon libraries. Specific 16S rRNA gene (V3-V4 region) is amplified by PCR using Illumina adapter overhang nucleotide sequences following Illumina protocols. After amplification, the mutiplexing step is performed using Nextera XT Index Kit. 16S amplicons are confirmed and checked with a Bioanalyzer DNA 1000 chip and libraries are sequenced using a 2x300pb paired-end run (MiSeq Reagent kit v3) on a MiSeq-Illumina platform (FISABIO sequencing service, Valencia, Spain). To rule out and control for possible reagent contamination, DNA-reagents and DNA-extraction and PCR amplification are also included and sequenced as controls.
Bioanalyzer dna 1000 chip
Manufactured by Agilent Technologies
Sourced in United States, Spain
The Bioanalyzer DNA 1000 chip is a lab equipment product from Agilent Technologies. It is designed for the analysis of DNA samples with fragment sizes ranging from 25 to 1,000 base pairs. The chip utilizes microfluidic technology to separate and detect DNA fragments, providing accurate size and concentration measurements.
Automatically generated - may contain errors
Lab products found in correlation
Miseq reagent kit v3, by Illumina (11 mentions)
Ampure xp bead, by Beckman Coulter (11 mentions)
Nextera xt index kit, by Illumina (11 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (10 mentions)
Miseq platform, by Illumina (10 mentions)
Miseq reagent kit v2, by Illumina (6 mentions)
Miseq system, by Illumina (6 mentions)
Hiseq 4000, by Illumina (5 mentions)
Truseq rna sample prep kit, by Illumina (5 mentions)
Hiseq 2000, by Illumina (4 mentions)
Nextera xt indices, by Illumina (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Miseq sequencer, by Illumina (3 mentions)
Bioanalyzer high sensitivity dna chip, by Agilent Technologies (3 mentions)
Agencourt ampure xp bead, by Beckman Coulter (3 mentions)
Trueseq stranded mrna kit with polya selection, by Illumina (3 mentions)
Nextseq, by Illumina (3 mentions)
Ampure spri beads, by Beckman Coulter (3 mentions)
Hiseq 2000 platform, by Illumina (3 mentions)
16s metagenomic sequencing library preparation guide, by Illumina (3 mentions)
87 protocols using bioanalyzer dna 1000 chip
1
16S rRNA Amplicon Sequencing for Microbiome Analysis
2
RNA Amplification and Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA of group 1 and 2 (Figure 1I ) was amplified using the Ovation® RNA-Seq System V2 (NuGEN, San Carlos, CA). Before amplification, all samples were lyophilized using a SpeedVac instrument and then suspended in 5 μl of nuclease-free water. The cDNAs were fragmented using a Bioruptor instrument with three 10 s (‘on’) cycles of sonication interrupted by 90 s pause periods (‘off’). The cDNAs of group 3 (Figure 1I ) was synthesized according to standard procedures. The cDNAs were quantified using the Nanodrop and Bioanalyzer DNA 1000 Chip. The libraries were loaded on a High Sensitivity ChIP and quantified on a Qubit instrument.
3
16S rRNA Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA prepared samples was used as template in PCR reactions to amplify the V3–V4 hypervariable region of the 16S rRNA gene by using the set of primers (forward: 5′TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGC3′ and reverse: 5′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTA CHVGGGTATCTAATCC3′) in which bases indexes were incorporated to perform multiplexing. The PCR reactions were performed using PrimeSTAR R Max DNA Polymerase (Takara Kusatsu, Shiga, Japan). The PCR products were analyzed by gel electrophoresis for verification then purified with Ampure magnetic purification beads (Beckman Coulter, Atlanta, GA, USA). For the preparation of the libraries: the concentration of the PCR products was quantified by SYBR Gold Nucleic Acid Gel Stain, normalized, then pooled in preparation for bridge amplification. The final library was checked on a Bioanalyzer DNA 1000 chip for size verification which expected as ~ 630 bp. The sequencing of V3–V4 amplicons was carried out at the 57,357 hospital (Egypt) using MiSeq Illumina sequencer (Illumina, Inc., Madison, WI, USA) in 2X251 bp by using the Illumina MiSeq Reagent Kit v2 (500 cycles; Illumina) according to the manufacturer’s protocol.
4
Metagenomic Sequencing of Gut Microbiome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from the biological samples as previously described.16 (link) Briefly, 100–125 mg of feces was weighed and homogenized in the presence of lysis buffer via bead beating with FastPrep-24 (MP Biomedicals, Irvine, CA). DNA was extracted following the commercial kit InviMag Stool DNA Kit (Stratec Molecular, Berlin, Germany) using the automated KingFisher DNA System (Thermo Fisher Scientific Oy, Vantaa, Finland). The KingFisher’s system protocol steps included nucleic acid binding on magnetic beads, five-step washing, and elution. Then, the total DNA concentration was measured using a Qubit® 2.0 Fluorometer (Life Technology, Carlsbad, CA) and normalized. A specific 16S rRNA gene region (V3–V4 region) was amplified following the 16S rDNA gene Metagenomic Sequencing Library Preparation Illumina protocol (Cod. 15044223 Rev. A). After 16S rDNA gene amplification, the multiplexing step was performed using Nextera XT Index Kit (FC-131-2001). One microliter of the PCR product was run on a Bioanalyzer DNA 1000 chip to verify the size; the expected size on a Bioanalyzer trace is ~550 bp. The libraries were sequenced using a 2 × 300 bp paired-end run (MiSeq Reagent Kit v3) on a MiSeq-Illumina platform according to the manufacturer’s instructions.
5
16S rRNA Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR reactions were performed using a primer pair based on the sequences of primers S-D-Bact-0341-b-S-17 and S-D-Bact-0785-a-A-2164 (link) for amplification of the variable regions V3 and V4 of 16S rRNA gene and including adapters as suggested on the Illumina workflow for 16S Metagenomic Sequencing Library Preparation. Forward primer 341F, 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and reverse primer 785R, 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC were used in PCR reactions (25 μL) performed with 12.5 ng of metagenomic DNA samples, KAPA HiFi HotStart ReadyMix (Kapa Biosystems, USA), 200 nM of each primer at 95 °C for 3 min followed by 25 cycles at 95 °C for 30 sec, 55 °C for 30 sec and 72 °C for 30 sec plus 72 °C for 5 min. Amplicon expected size of ~550 bp was verified with Bioanalyzer DNA 1000 chip. PCR product cleanup was performed with AMPure XP beads (Beckman Coulter, Inc., USA). Dual indexes were attached using the Nextera XT Index Kit and after a second round of PCR cleanup with AMPure XP beads, V3–V4 16S indexed amplicons libraries were validated by running on a Bioanalyzer High Sensitivity DNA chip to verify the expected size of ~630 bp.
6
Microbiome DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HM samples (1.5 mL) were centrifuged (20,000× g, 20 min, 4 °C) to remove fat and washed twice with 500 µL saline solution. For total DNA extraction, MasterPure™ Complete DNA and RNA Purification Kit (Epicentre, Madison, WI, USA) was used. DNA concentrations were measured using a Qubit 2.0 fluorometer (Life Technology, Carlsbad, CA, USA) and normalized to 5 ng μL−1 for 16S rRNA gene (V3–V4 regions) sequencing using Nextera XT Index Kit. Amplicons were reviewed with a Bioanalyzer DNA 1000 chip, and libraries were sequenced using a 2 × 300 bp paired-end run (MiSeq Reagent kit v3) on a MiSeq–Illumina platform (FISABIO sequencing service, Valencia, Spain).
7
16S rDNA Metagenomic Sequencing of Clinical Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA from clinical samples was extracted using the DNAeasy kit (QiaGen, Barcelona, Spain). Variable V3 and V4 regions of the 16S rDNA gene were amplified following the 16S Metagenomic Sequencing Library Preparation Illumina protocol (Cod. 15044223 Rev. A, Illumina, Inc., San Diego, CA, USA). The full-length primer sequences including Illumina adapter overhang nucleotide sequences were selected according to Klindworth et al. [57 (link)] as follows:
Forward primer: 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACG-GGNGGCWGCAG-3′.
Reverse primer: 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTA-CHVGGGTATCTAATCC-3′.
After 16S rDNA gene amplification, the multiplexing step was performed using Nextera XT Index Kit (FC-131-2001). A volume of 1 μL of the PCR product was run on a Bioanalyzer DNA 1000 chip to verify the size (~550 bp expected) on a Bioanalyzer 2100 (Agilent, Santa Clara, CA, USA). After size verification, libraries were sequenced using a 2 × 300 bp paired-end run (MiSeq Reagent kit v3, MS-102-3003) on an Illumina MiSeq Sequencer according to the manufacturer’s instructions.
Forward primer: 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACG-GGNGGCWGCAG-3′.
Reverse primer: 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTA-CHVGGGTATCTAATCC-3′.
After 16S rDNA gene amplification, the multiplexing step was performed using Nextera XT Index Kit (FC-131-2001). A volume of 1 μL of the PCR product was run on a Bioanalyzer DNA 1000 chip to verify the size (~550 bp expected) on a Bioanalyzer 2100 (Agilent, Santa Clara, CA, USA). After size verification, libraries were sequenced using a 2 × 300 bp paired-end run (MiSeq Reagent kit v3, MS-102-3003) on an Illumina MiSeq Sequencer according to the manufacturer’s instructions.
8
Bacterial 16S rRNA Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An aliquot of the two first pooled samples for each host genetic group was centrifuged at 7400 g for 10 min at 4ºC, and the supernatant was obtained and stored at -80ºC until analysis. A total of 8 pools (2 for each host genetic group) were analysed. Total DNA was extracted using the NucliSens easyMag automated system (bioMérieux, Marcy l'Etoile, France) according to the manufacturer's instructions. We used microbial genomic DNA (5 ng/μl in 10 mM Tris pH 8.5) to initiate the protocol. The V3-V4 region of the bacterial 16S rRNA gene sequences was amplified using the primer pair 341F-805R [38] (link), containing the gene-specific sequences and Illumina adapter overhang nucleotide sequences.
Primer sequences were forward primer:
(5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCA G3'; reverse primer: 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCT AATCC3'). After 16S rDNA gene amplification, the multiplexing step was performed using the Nextera XT Index Kit (FC-131-1096). We ran 1 μl of the PCR product on a Bioanalyzer DNA 1000 chip to verify the size; the expected size on a Bioanalyzer trace is ~550 bp. After size verification, the libraries were sequenced using a 2x300 pb pairedend run (MiSeq Reagent kit v3 (MS-102-3001)) on a MiSeq Sequencer, following the manufacturer's instructions (Illumina, Inc., San Diego, CA, USA).
Primer sequences were forward primer:
(5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCA G3'; reverse primer: 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCT AATCC3'). After 16S rDNA gene amplification, the multiplexing step was performed using the Nextera XT Index Kit (FC-131-1096). We ran 1 μl of the PCR product on a Bioanalyzer DNA 1000 chip to verify the size; the expected size on a Bioanalyzer trace is ~550 bp. After size verification, the libraries were sequenced using a 2x300 pb pairedend run (MiSeq Reagent kit v3 (MS-102-3001)) on a MiSeq Sequencer, following the manufacturer's instructions (Illumina, Inc., San Diego, CA, USA).
9
16S rDNA Amplicon Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An aliquot of 5 ng/μl of genomic DNA (in 10 mM Tris pH 8.5) was used to initiate the 211 protocol. After 16S rDNA gene amplification, the mutiplexing step was performed 212 using Nextera XT Index Kit (FC-131-1096 ). An aliquot of 1 μl of the PCR product on a 213 Bioanalyzer DNA 1000 chip was used to verify the size (expected size on a Bioanalyzer 214 trace was ~550 bp). After size verification, the libraries were sequenced using a 215 according to manufacturer's instructions (Illumina). Data Quality assessment was 217 performed by using the prinseq-lite program with the following parameters: min_length 218 of 50 bp and trim_qual_right of 30. The reads for filtered samples ranged between 219 92128 and 122324, for denoised samples ranged between 92128 and 122324, for 220 merged samples between 13805 and 45299, and for non-chimeric between 13683 and 221
10
Fecal DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 0.18–0.22 g of feces content of each sample with the DNeasy® PowerLyzer® PowerSoil® isolation kit (Qiagen) according to the manufacturer’s recommendations. The concentration of the extracted DNA was determined by fluorometric Quantification (Qubit 2.0 Fluorometer, Thermo Fisher Scientific) and stored at − 20 °C until use. Library preparation was preformed using the Nextera XT DNA Library Preparation Kit (Illumina, Int., San Diego, CA, USA) according to the manufacturer’s recommendation, by the DTU in-house facility (DTU Multi-Assay Core (DMAC), Technical University of Denmark). Size confirmation of the target was performed on a Bioanalyzer DNA 1000 chip (Agilent Technology, CA), and the DNA concentration was determined with Qubit 2.0 Fluorometer. DNA libraries were mixed in equimolar ratios. Sequencing was performed as a 150-bp paired-end run on HiSeq 3000/4000 (Illumina Int., San Diego, CA USA) at Novogene Europe’s facility following the manufacturer’s recommendations.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!