Dual glo luciferase kit

The glt1 mRNA 3′ UTR luciferase reporter construct containing three adjacent miR-218-binding sites was generated via PCR using mouse genomic DNA as a template using the following primers: 5′ tcatactcaaatcatgtcttctg 3′; 5′ ctttcactaagtgttttaactac 3′. The corresponding glt1 3′ UTR with miR-218 sites deleted was chemically synthesized (Genscript). The glt1 3′ UTR containing miR-132-binding sites was synthesized (Integrated DNA Technologies) as follows: Wild Type 5′ taacaacagactgttatccttatc 3′; Mutant 5′ taacaacatccttatc 3′. PCR products or synthesized oligos were cloned into the pmirGLO vector (Promega). Reporter constructs were confirmed by sequencing. Luciferase activity was measured 48 h after transfection of HEK 293 cells using the Dual-Glo luciferase kit (Promega). Coexpressed Renilla luciferase on the pmirGLO vector was used as an internal control to normalize the firefly luciferase activity.

HEK293T cells were seeded in 12-well plates. The next day, cells were transfected with VF-plasmids along with firefly luciferase reporter plasmid under the control of wild-type (GCCACGTGGCCACGTGGCCACGTGGC) or mutant (GCCTCGAGGCCTCGAGGCCTCGAGGC) E-box and Renilla luciferase, which served as an internal control. Cells were collected, centrifuged at 1200 rpm, and re-suspended in 50 μl of phosphate-buffered saline (VWR, Cat# 45000-446). 10 μl of cells was transferred to a 384-well plate, and the MYC reporter assay was performed using Dual-Glo luciferase kit (Promega, Cat# E2920) following the manufacturer’s instructions. Firefly luciferase expression was normalized to the control Renilla expression. Data were analyzed on Graphpad Prism software.

Cells were seeded to 2 × 10⁵ cells/well 16 h before of the transient transfection with 150 ng of SDC-1 promoter segment into pGL3 luciferase, or the control pGL3 luciferase empty vector; plus 100 ng of pcDNA 3.1 ZEB1 or control pcDNA 3.1 (empty vector). pRSV-40 plasmid was co-transfected as control. 48 h after transient transfection, the luciferase and renilla luminescence lectures were obtained using Dual Glo luciferase Kit (E2940, Promega), in a luminometer BioTek model SynergyHT.

To evaluate the effect of H5N1 IAV NS1 and PA-X proteins on induction of IFN responses, HEK293T cells (96-well plate format, 5 × 10⁴ cells/well, triplicates) were transiently co-transfected with 100 ng/well of pCAGGS plasmids encoding OR or CIR HA-tagged NS1 and/or PA-X proteins, or empty plasmid as control, together with 50 ng/well of a plasmid expressing firefly luciferase (Fluc) under the control of the IFN-sensitive response element (ISRE) promoter (pISRE-Fluc) [41 (link)], together with 20 ng/well of a pCAGGS plasmid encoding Rluc, using calcium phosphate (Agilent Technologies, Santa Clara, CA, USA). At 24 h p.t, cells were washed with PBS and infected with a multiplicity of infection (MOI) of 3 with the Sendai virus (SeV), strain Cantell, as previously described [41 (link)]. At 24 h post-infection (h p.i), cells were lysed using passive lysis buffer (Promega). Luciferase expression in the cell lysates was determined using a dual-Glo luciferase kit (Promega) according to the manufacturer’s instructions. Measurements were recorded with a Lumicount luminometer (Apliskan, Thermo Scientific), and the mean values and standard deviations were calculated. Statistical analysis was performed using a two-tailed Student t test and GraphPad Prism software (v8).