The largest database of trusted experimental protocols

Nc sirna

Manufactured by GenePharma
Sourced in China, United States

NC siRNA is a gene silencing tool used in research applications. It is a non-targeting siRNA sequence that serves as a negative control to help assess the specificity of gene knockdown experiments.

Automatically generated - may contain errors

301 protocols using nc sirna

1

VPS4, ALIX, and TSG101 Silencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
VPS4 (encoding vacuolar protein sorting 4) expresses two transcripts, VPS4A and VPS4B. The VPS4-specific siRNA (5′-GGAUGUCCCUGGAGAUAAAtt-3′), which targeted both transcripts, and a negative control siRNA (NC), were purchased from GenePharma (Shanghai, China).
The siRNA (5′-GAACAAAUGCAGUGAUAUA-3′) specifically targeting position 2063 to 2081 bp of ALIX and an NC siRNA were purchased from GenePharma.
The siRNA (5′-CCUCCAGUCUUCUCUCGUC-3′) specifically targeting position 414 to 432 bp of TSG101 and an NC siRNA were purchased from GenePharma.
+ Open protocol
+ Expand
2

Transfecting RAW264.7 Cells with OSM-siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
RAW264.7 cells were seeded in six-well culture plates with Ti-5Cu alloy at a density of 1 × 105 per well. The cells were transfected with siRNA when they became 50%–70% confluent. OSM-siRNA and NC-siRNA were purchased from GenePharma (Suzhou, China); the sequences of OSM-siRNA are 5′-CACUCUUGGAGCCCUAUAUTT-3′ (sense) and 5′-AUAUAGGGCUCCAAGAGUGTT-3′ (antisense); the sequences of NC-siRNA are 5′-UUCUCCGAACGUGUCACGUTT-3′ (sense) and 5′-ACGUGACACGUUCGGAGAATT-3′ (antisense). siRNA was transfected into RAW264.7 cells using GP-transfect-Mate (GenePharma, China) according to the manufacturers instructions. The medium was replaced with DMEM complete medium after 24 h, and then, the supernatant was collected after 48 h to prepare the conditioned medium as mentioned above.
+ Open protocol
+ Expand
3

Regulation of HemECs by lncRNA MEG8 and miR-203

Check if the same lab product or an alternative is used in the 5 most similar protocols
lncRNA MEG8 small interfering RNA (siRNA), negative control (NC) siRNA and miR-203 inhibitor were purchased from Shanghai GenePharma Co., Ltd. The sequences for lncRNA MEG8 siRNA, NC siRNA, miR-203 inhibitor and NC inhibitor were as follows: lncRNA MEG8 sense, 5′GGCCAGCUGAUUUAAUAAUUU3′, lncRNA MEG8 antisense, 5′AUUAUUAAAUCAGCUGGCCUU3′; NC siRNA sense, 5′GAAUUAAUUAAAGAUGGCCCGUUGUAC3′, NC siRNA antisense, 5′UCAUCGAAGUUAUAGGGAUACAUUACGUGAUC3′; miR-203 inhibitor, 5′CUAGUGGUCCUAAACAUUUCAC3′; NC inhibitor, 5′CAGUACUUUUGUGUAGUACAA3′. A total of 2×105 HemECs were seeded into 6-well plates 24 h prior to transfection. Following incubation, the HemECs were transfected with 50 pM NC siRNA, 50 pM lncRNA MEG8 siRNA, 50 pM NC inhibitor, 50 pM miR-203 inhibitor or 50 pM lncRNA MEG8 siRNA + 50 pM miR-203 inhibitor using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) for 6 h at 37°C, according to the manufacturer's protocol. Untransfected HemECs were used as the control.
+ Open protocol
+ Expand
4

Magnetospirillum gryphiswaldense Cellular Uptake

Check if the same lab product or an alternative is used in the 5 most similar protocols
BMs extracted from Magnetospirillum gryphiswaldense MSR-1 were presented kindly by professor Li Ying and Jiang Wei (Department of Microbiology, China Agricultural University). STAT 3 siRNA and siRNA (NC) were purchased from GenePharma Co., Ltd. (Shanghai, China), siRNA (NC) was used as the negative control of STAT 3 siRNA without homology. Branched PEI (MW: 25 KD) was purchased from Sigma Aldrich (USA). The cervical carcinoma cell line (HeLa cells), was obtained from China Academy Typical Culture Preservation Committee Cell Library (Shanghai, China). Cell culture medium was composed of Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). The cells were incubated in humidified air maintained at 37 °C with 5% CO2.
+ Open protocol
+ Expand
5

Targeted Silencing of AC005592.2 in Colorectal Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three siRNAs targeting AC005592.2 (siRNA-78 sense strand: GGAAGCUAGUAGAAGAUUUTT and antisense strand: AAAUCUUCUACUAGCUUCCTT; siRNA-273 sense strand: GAAUGGCACUUUGGACAAUTT and antisense strand: AUUGUCCAAAGUGCCAUUCTT; siRNA-402 sense strand: GGAGUAGGCUGACCAGUUATT and antisense strand: UAACUGGUCAGCCUACUCCTT) and scrambled negative control siRNA (siRNA-NC, siRNA-NC sense strand: UUCUCCGAACGUGUCACGUTT and antisense strand: ACGUGAGCACUUCGGAGAATT) were synthesized and purchased from GenePharma (Shanghai, China). The Lipofectamine RNAiMAX kit (Invitrogen, USA) was used to transfect siRNA into CRC cells according to the manufacturer’s instructions. Two of the three siRNA sequences were selected for further studies based on the knockdown efficiency, as confirmed by qRT-PCR.
+ Open protocol
+ Expand
6

Modulating MC3T3-E1 Osteoblast Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
MC3T3-E1 cells were grown in DMEM/F12 media (Hyclone, UT, USA, #SH30023.01B) with 10% FBS (Gibco, GI, USA, #10099141) and 1% penicillin/streptomycin (Hyclone, UT, USA, #SV30010). Transfection of agomiR-6979-5p, agomiR-NC, antagomiR-6979-5p, antagomiR-NC, lncRNA Rhno1, silncRNA Rhno1, and siRNA-NC (GenePharma, Shanghai, China) at 200uM was conducted using Lipofectamine 3000 (ThermoFisher Scientific, MA, USA, #L3000001) based on provided directions. Lipofectamine 3000 was also used to transfect cells with miRNAs or siRNA oligos. BMP2 siRNA, silncRNA Rhno1, and siRNA-NC (GenePharma, Shanghai, China) were transfected at 50 nM.
+ Open protocol
+ Expand
7

Modulating Cellular Pathways with Plasmids and siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cox15, Bcl6, SIRT1, HIF1-α, HMGB1, Tet2-specific siRNA and non-specific control (NC) siRNAs were purchased from Genepharma. Cells were seeded into 6-well plates at a density of 1 × 105 cells/well in 2 ml complete medium. After overnight incubation, the media was removed and replaced with 500 μl serum-free media and the Lipofectamine RNAiMAX (Thermo Scientific, USA) /siRNA complexes were added to each well. After 4 h, the media was replaced with 2 ml fresh medium containing 10% FBS, and incubated for another 24 h or 48 h at 37 °C. All transfection experiments were performed in triplicate.
The constitutively active Akt or Tet2 plasmids or empty plasmids were purchased from Addgene. Bcl6- or SIRT1-expressing plasmids were purchased from GeneChem. Cells were seeded into 6-well plate the day before transfection. The myr-Akt1 or empty plasmids were transfected with Lipofectamine 2000 (Invitrogen, USA) according to the protocol suggested by the manufacture. After 48 h of transfection, the positive clones were selected.
+ Open protocol
+ Expand
8

Silencing LSINCT5 in Ovarian Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human ovarian cancer cell lines (SKOV3, OVCAR-3 and 3AO) were obtained from the Chongqing Key Laboratory of Oncology and were cultured in RPMI-1640 media (Wuhan Boster Biological Technology, Ltd., Wuhan, China) containing 10% foetal bovine serum (FBS) (Wuhan Boster Biological Technology, Ltd.), penicillin and streptomycin at 37°C in a 5% CO2 incubator. The LSINCT5-specific small interfering RNAs (siRNAs) and negative control (NC) siRNAs (GenePharma, Shanghai, China) were transfected to SKOV3 cells by following the manufacturers manual. The target sequences for the LSINCT5 siRNAs were 5′-CCAGCUACAAACCUCUGAATT-3′ and 5′-UUCAGAGGUUUGUAGCUGGTT-3′ (LSINCT5-siRNA-1); 5′-GAACUGGAUUAGUGUUAAATT-3′ and 5′-UUUAACACUAAUCCAGUUCTT-3′ (LSINCT5-siRNA-2); 5′-CCUCCAAACACAUGGAUAATT-3′ and 5′-UUAUCCAUGUGUUUGGAGGTT-3′ (LSINCT5-siRNA-3).
+ Open protocol
+ Expand
9

Silencing SOX5, DNMT1, and p21 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SiRNAs against SOX5 (SOX5-siRNAs), DNMT1 (DNMT1-siRNAs), p21 (p21-siRNAs) and negative control siRNA (NC-siRNAs) were synthesized by Genepharma (Shanghai, China), and the sequences were shown in
Table 2.

Table 2 The sequences of siRNAs used in the study

Name

Sequence (5′→3′)

siSOX5-1

sense

GACCAUGAUGCUGUCACCAAGGCAA

antisense

UUGCCUUGGUGACAGCAUCAUGGUC

siSOX5-2

sense

GAGAAGUACCCUGACUAUAAGUACA

antisense

UGUACUUAUAGUCAGGGUACUUCUC

siSOX5-3

sense

CAAGACAGCAGCAGCAGCTTCTACA-3′

antisense

TGTAGAAGCTGCTGCTGCTGTCTTG

siDNMT1-1

sense

GCCUCAUCGAGAAGAAUAUTT

antisense

AUAUUCUUCUCGAUGAGGCTT

siDNMT1-2

sense

GGGACUGUGUCUCUGUUAUTT

antisense

AUAACAGAGACACAGUCCCTT

siDNMT1-3

sense

CAGTCCCGAGTATGCGCCCATATTT

antisense

AAATATGGGCGCATACTCGGGACTG

sip21-1

sense

GCGAUGGAACUUCGACUUUTT

antisense

AAAGUCGAAGUUCCAUCGCTT

sip21-2

sense

GAUGGAACUUCGACUUUGUTT

antisense

ACAAAGUCGAAGUUCCAUCTT

sip21-3

sense

GACCAUGUGGACCUGUCACTT

antisense

GUGACAGGUCCACAUGGUCTT

siNC

sense

UUCUCCGAACGUGUCACGUTT

antisense

ACGUGACACGUUCGGAGAATT

The sequences of
SOX5,
DNMT1 and
p21 were synthesized by Generay (Shanghai, China) and inserted into the pCDNA3.1 vector. The plasmids were transfected into the cells using Lipofectamine-2000 (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. After 6 h of transfection, the medium containing the transfection reagent was replaced with fresh medium. Forty-eight hours after transfection, the cells were collected for further study.
+ Open protocol
+ Expand
10

Silencing TCONS_00029809 in Breast Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
Negative control (NC)-siRNAs and TCONS_00029809 siRNAs (si-TCONS_00029809) were acquired from GenePharma (Shanghai, China). MCF7 and MDA-MB-231 cells (1 × 105 cells/well) were evenly and gently placed into six-well plates and cultured for 12 hours. The cells were then transfected with NC and si-TCONS_00029809 using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!