HEK293 (human embryonic kidney, ATCC catalog no. CRL-1573) and HFF-1 (human foreskin fibroblast, ATCC catalog no. SCRC-1041) cells were maintained in Dulbecco's modified Eagle's medium (4,500 mg/liter glucose; Welgene, Daegu, Republic of Korea) supplemented with 10% (v/v) fetal bovine serum (Cellgro, Manassas, VA) and 1% penicillin/streptomycin at 37 °C in a humidified 5% CO2 incubator. To evaluate the effects of glucose deprivation, cells were rinsed with phosphate-buffered saline (PBS) and then cultured in glucose-free Dulbecco's modified Eagle's medium (Welgene, Deagu, Republic of Korea) containing 10% (v/v) fetal bovine serum and 1% penicillin/streptomycin for up to 4 days.
Dulbecco s modified eagle s medium
Manufactured by Welgene
Sourced in United States, Cameroon, Germany
Dulbecco's modified Eagle's medium (DMEM) is a cell culture medium that provides essential nutrients and growth factors for the cultivation of various cell types in vitro. It is a widely used basal medium for supporting the growth and maintenance of a diverse range of mammalian cell lines.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Welgene (71 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (52 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (32 mentions)
Penicillin streptomycin, by Welgene (31 mentions)
Penicillin, by Thermo Fisher Scientific (22 mentions)
Streptomycin, by Thermo Fisher Scientific (21 mentions)
Penicillin, by Welgene (15 mentions)
Streptomycin, by Welgene (13 mentions)
Rpmi 1640 medium, by Welgene (9 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (7 mentions)
Penicillin streptomycin solution, by Welgene (6 mentions)
Antibiotic antimycotic solution, by Welgene (5 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (5 mentions)
1640 medium, by Welgene (4 mentions)
Raw264.7 cell, by American Type Culture Collection (4 mentions)
Amphotericin b, by Welgene (4 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (4 mentions)
Methyl thiazolyl tetrazolium (mtt), by Merck Group (4 mentions)
Lipopolysaccharides (lps), by Merck Group (4 mentions)
Trypsin edta, by Thermo Fisher Scientific (4 mentions)
188 protocols using dulbecco s modified eagle s medium
1
Glucose Deprivation Effects on HEK293 and HFF-1 Cells
2
Assessing Cellular Viability and Oxidative Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dimethyl sulfoxide was purchased from Sigma- Aldrich (Merck Millipore, Darmstadt, Germany). Dulbecco's modified Eagle's medium, fetal bovine serum (FBS), penicillin-streptomycin and trypsin-ethylenediaminetetraacetic acid were obtained from Welgene, Inc. (Gyeongsan-si, South Korea). Acridine orange (AO), ethidium bromide (EB) and 2′,7′-dichlorofluorescein diacetate (DCFH-DA) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). Primers were obtained from Macrogen Inc. (Seoul, South Korea).
3
MERS-CoV Infection in hDPP4-Tg Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MERS-CoV was propagated in Vero E6 cells, which were grown in Dulbecco’s Modified Eagle’s Medium (Welgene, Korea) supplemented with 10% FBS (Gibco-Thermo Fisher Scientific) at 37°C in a humidified CO2 incubator. MERS-CoV was passed six times in Vero E6 cells and used to assess the morbidity and mortality in the identified hDPP4-Tg mice. Briefly, hDPP4-Tg and their transgene-negative littermates were anesthetized and inoculated intranasally with 105 plaque-forming units (PFUs) of MERS-CoV in a total volume of 60 μl. hDPP4-Tg and transgene-negative littermates were weighed and monitored daily for clinical signs of disease, including appearance, abnormalities of behavior or movements, decreased activity or enhanced responsiveness, weight loss, and death. Some infected mice were sacrificed at the indicated time points post-infection to obtain tissue specimens to assess the viral loads and the expression levels of target genes associated with the histopathological changes using real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and histopathologic evaluation by hematoxylin-eosin (H&E) staining.
4
Cell Culture Protocols for Cancer Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human H460 lung cancer cells and murine SCC7 squamous cancer cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in Roswell Park Memorial Institute 1640 medium (Welgene, Daegu, Republic of Korea). Mouse B16-F10 melanoma cells were purchased from the Korea Cell Line Bank (Seoul, Republic of Korea) and maintained in Dulbecco’s Modified Eagle’s Medium (Welgene). Each medium was supplemented with 10% heat-inactivated fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, USA) and 100 units/mL penicillin/streptomycin. Cells were grown in incubators in a humid atmosphere of 95% air and 5% CO2.
5
Generating Bone Marrow-Derived Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 (H-2Kb and I-Ab), C57BL/6J TLR2 knockout (TLR2-/-; B6.129-Tlr2tm1Kir/J), C57BL/10 TLR4 knockout (TLR4-/-; C57BL/10ScNJ), and BALB/c mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). All mice were maintained under specific pathogen-free conditions in the Medical Research Center of Chungnam National University.
Bone marrow-derived macrophages (BMDMs) were cultured in Dulbecco’s modified Eagle’s medium (Welgene Co., Daegu, Korea) supplemented with 10% fetal bovine serum (FBS) (Welgene), 100 unit/ml penicillin/100 μg/ml streptomycin (Welgene) and 50 ng/ml mouse macrophage colony stimulating factor (M-CSF) (R&D Systems, Minneapolis, MN, USA) at 37°C and 5% CO2 for 6 days.
Bone marrow-derived macrophages (BMDMs) were cultured in Dulbecco’s modified Eagle’s medium (Welgene Co., Daegu, Korea) supplemented with 10% fetal bovine serum (FBS) (Welgene), 100 unit/ml penicillin/100 μg/ml streptomycin (Welgene) and 50 ng/ml mouse macrophage colony stimulating factor (M-CSF) (R&D Systems, Minneapolis, MN, USA) at 37°C and 5% CO2 for 6 days.
6
Melanoma and Keratinocyte Cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The melanoma cell lines (SK-MEL-28 and G-361) utilized in the current study were procured from the Korea Cell Line Bank (Seoul, Republic of Korea). These cells were cultured in Dulbecco’s Modified Eagle’s Medium (WelGene, Gyeongsan, Republic of Korea) supplemented with 10% fetal bovine serum (FBS; Gibco, Gaithersburg, MD, USA) and 100 U/mL penicillin-streptomycin (PS; Gibco, Gaithersburg, MD, USA) at 37 °C with 5% CO2 in a humidified incubator. Cell dissociation was performed using 0.25% trypsin-EDTA (Gibco, Gaithersburg, MD, USA).
A non-tumoral human epithelial cell line, HaCaT cells, was generously provided by Professor Jong Kun Park at Wonkwang University (Iksan, Republic of Korea). HaCaT cells were cultured in RPMI-1640 medium (WelGene, Gyeongsan, Republic of Korea) supplemented with 10% FBS and 100 U/mL PS at 37 °C and 5% CO2 in a humidified incubator until utilized.
A non-tumoral human epithelial cell line, HaCaT cells, was generously provided by Professor Jong Kun Park at Wonkwang University (Iksan, Republic of Korea). HaCaT cells were cultured in RPMI-1640 medium (WelGene, Gyeongsan, Republic of Korea) supplemented with 10% FBS and 100 U/mL PS at 37 °C and 5% CO2 in a humidified incubator until utilized.
7
Ovarian Cancer Cell Line Classification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Six ovarian cancer cell lines (A2780, CAOV3, TOV-112D, A2780cis, OVCAR-3, SKOV-3) were classified for their cisplatin resistance, using a previous report [28 (link)]. A2780, CAOV3 and TOV-112D were categorized as cisplatin-sensitive (CSC) and A2780cis, OVCAR-3, and SKOV-3 as cisplatin-resistant (CRC). A2780, A2780cis, and OVCAR-3 cells were cultured in RPMI1640 medium (Welgene, LM 011-03, Daegu, South Korea). CAOV3 and SKOV-3 cells were cultured in Dulbecco’s Modified Eagle’s Medium (Welgene, LM 001-05, Daegu, South Korea) and McCoy’s 5a (Gibco, 16600-082, Gaithersburg, MD, USA) respectively. TOV-112D cells were cultured in MCDB105 (Welgene, LM 016-50, Daegu, South Korea) and Medium199 (Gibco, 11150-059, Gaithersburg, MD, USA) in 1:1 proportion. All culture media were supplemented with 10% FBS (Atlas, Fort Collins, CO, USA), 100 UmL penicillin and 100 μ/mL streptomycin, and maintained at 37 °C and 5% CO2. Additionally, for culturing A2780cis, cisplatin (Sigma, St. Louis, MO, USA), 100 μM, was added to the medium every 2–3 passages to maintain cisplatin resistance.
8
Silencing CTCF in Human Extravillous Trophoblast Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human extravillous trophoblast cell line Swan 71 was kindly provided by J.‐Y. Kwon (Institute of Women's Life Medical Science, Yonsei University Health System, Seoul, Korea). These cells were cultured in Dulbecco's modified Eagle's medium (WELGENE Inc., Daegu, Korea) supplemented with 10% FBS (WELGENE Inc.), 1× antibiotic‐antimycotic solution (WELGENE Inc.), 1× HEPES buffer solution (WELGENE Inc.), and 1× non‐essential amino acid solution (WELGENE Inc.) in humidified air at 37 °C and 5% CO2. For gene knockdown (KD) study, Swan 71 cells were seeded at 1 × 106 cells in 100 mm culture plate and were transfected with 10 nm of siRNA using G‐fectin (Genolution, Seoul, Korea) for 48 h. ON‐TARGET plus CTCF siRNA (L‐020165‐00‐0005) were purchased from Dharmacon (Cambridge, UK), which utilizes a patented dual‐strand modification to reduce off‐target effects. Negative control siRNA (sense sequence, 5′‐CCUCGUGCCGUUCCAUCAGGUAGUU‐3′; antisense sequence, 5′‐CUACCUGAUGGAACGGCACGAGGUU‐3′) was provided by Genolution Inc.
9
Osteoclast Differentiation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dulbecco’s modified Eagle’s medium (DMEM), -minimum essential
Eagle’s medium (α-MEM), penicillin-streptomycin solution, and
fetal bovine serum (FBS) were purchased from Welgene (Gyeongsan, Korea). TaqMan
Gene Expression Master Mix, TaqMan probes (5’-fluorescein based reporter
dye; 3’-TAMRA quencher), and High-Capacity RNA-to-cDNA Kit were purchased
from Applied Biosystems (Foster City, CA, USA). RANKL was purchased from
purchased ProSpec (Rehovot, Israel). All other reagents used in the experiment
were purchased from Sigma-Aldrich (St. Louis, MO, USA).
Eagle’s medium (α-MEM), penicillin-streptomycin solution, and
fetal bovine serum (FBS) were purchased from Welgene (Gyeongsan, Korea). TaqMan
Gene Expression Master Mix, TaqMan probes (5’-fluorescein based reporter
dye; 3’-TAMRA quencher), and High-Capacity RNA-to-cDNA Kit were purchased
from Applied Biosystems (Foster City, CA, USA). RANKL was purchased from
purchased ProSpec (Rehovot, Israel). All other reagents used in the experiment
were purchased from Sigma-Aldrich (St. Louis, MO, USA).
10
Culturing A549 and Plat-A Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 cells (Korean Cell Line Bank, Seoul, Korea; 10185) were cultured in RPMI 1640 medium (Welgene, Gyeongsan, Korea) with 10% heat-inactivated fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, Waltham, MA) and 1% penicillin/streptomycin (Gibco). Platinum-A (Plat-A) (Cell Biolabs, San Diego, CA; RV-102) cells were grown in Dulbecco’s Modified Eagle’s Medium (Welgene) supplemented with 10% FBS (Gibco) and 1% penicillin/streptomycin and selected by 5 μg/ml puromycin (Sigma-Aldrich) and 10 μg/mL blasticidin (Sigma-Aldrich) prior to produce retroviruses. All cells were incubated at 37°C in with 5% CO2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!