Epz5676

Manufactured by Selleck Chemicals

Sourced in United States

EPZ5676 is a chemical compound used in laboratory settings. It functions as a selective inhibitor of the histone-lysine N-methyltransferase SETD2. This enzyme is responsible for methylation of histone H3 at lysine 36.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Pinometostat EPZ5676 (2 citations)

14 protocols using epz5676

Evaluating Menin-MLL Inhibitors in Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cell lines were incubated with increasing concentrations of the menin-MLL interaction inhibitors MI-136 (S7815) or MI-503 (S7817), both purchased from Selleckchem (Houston, TX, USA) or vehicle (DMSO, Merck) as control. PEO1 and PEO4 cell lines were exposed to a combination of MI-136 and DOT1L inhibitor EPZ5676 (S7062, Selleckchem), at the indicated concentrations or vehicle (DMSO) as control.

Alexandrova E., Lamberti J., Memoli D., Quercia C., Melone V., Rizzo F., Tarallo R., Giurato G., Nassa G, & Weisz A. (2022). Combinatorial targeting of menin and the histone methyltransferase DOT1L as a novel therapeutic strategy for treatment of chemotherapy-resistant ovarian cancer. Cancer Cell International, 22, 336.

+ Open protocol

+ Expand

AlphaLISA Cytokine Assay for LPS-Stimulated Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For AlphaLISA, 10000 cells/well were seeded on a 384-well plate (#6005350, Perkin Elmer, Waltham, MA, USA) using the MultiFlo FX Microplate Dispenser. The next day, cells were treated with LPS (L9143-02, Sigma-Aldrich, Saint Louis, MO, USA) at a final concentration of 10 µg/mL, the plates were then incubated at 37 °C for 4 and 24 h, and the TNFa concentration was measured using AlphaLISA (Perkin Elmer, Waltham, MA, USA) on the Spark reader (Tecan, Männedorf, Switzerland) and the AlphaScreen module as per the manufacturer’s protocol. The CellTiter-Glo Luminescent Cell Viability Assay (Promega, Madison, WI, USA) microplate assay was used to measure cell viability. Before the LPS challenge, cells were pre-treated for 1 h with the following drugs purchased from Selleckchem: AZD6244, SCH772984, MS-275, EX527, EPZ-5676, EPZ-6438, ORY-1001, RVX-208, OTX015, and (+)-JQ1 targeting the chromatin-associated proteins MEK 1/2, ERK 1/2, HDAC 1/2/3, SIRT1, DOT1L, EZH2, LSD1, BRD 2/3/4, BRD2/3, and BRD4 (Selleckchem, Houston, TX, USA), respectively, at the concentrations of 5, 1, 0.2, 0.04, 0.008, 0.0018, and 0.00032 µM. Drugs were dispensed using the Microlab STAR unit (Hamilton, Reno, NV, USA), while the transfer and media dilutions for the AlphaScreen readout were performed with the CyBio SELMA liquid handler (Analytic Jena, Jena, Germany). Measurements were performed in 12-plicate.

Kopczynski M., Rumienczyk I., Kulecka M., Statkiewicz M., Pysniak K., Sandowska-Markiewicz Z., Wojcik-Trechcinska U., Goryca K., Pyziak K., Majewska E., Masiejczyk M., Wojcik-Jaszczynska K., Rzymski T., Bomsztyk K., Ostrowski J, & Mikula M. (2021). Selective Extracellular Signal-Regulated Kinase 1/2 (ERK1/2) Inhibition by the SCH772984 Compound Attenuates In Vitro and In Vivo Inflammatory Responses and Prolongs Survival in Murine Sepsis Models. International Journal of Molecular Sciences, 22(19), 10204.

+ Open protocol

+ Expand

Dose-Dependent Cytotoxicity Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 100,000 cells were seeded in 96‐well tissue culture plates, in 200 μl culture medium containing the indicated concentration of inhibitor. Two inhibitors were used: SGC‐0946 (Structural Genomics Consortium) and EPZ‐5676 (Pinometostat; Selleck Chemicals). Cell viability was determined after three days, as described above. Data were normalized, with the maximum of each cell line to 100% and background fluorescence set to 0%. GraphPad Prism was used to fit log(inhibitor) vs normalized response curves with a variable slope.

Vlaming H., McLean C.M., Korthout T., Alemdehy M.F., Hendriks S., Lancini C., Palit S., Klarenbeek S., Kwesi‐Maliepaard E.M., Molenaar T.M., Hoekman L., Schmidlin T.T., Altelaar A.M., van Welsem T., Dannenberg J., Jacobs H, & van Leeuwen F. (2019). Conserved crosstalk between histone deacetylation and H3K79 methylation generates DOT1L‐dose dependency in HDAC1‐deficient thymic lymphoma. The EMBO Journal, 38(14), e101564.

+ Open protocol

+ Expand

DOT1L Inhibition Pharmacology Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

For all assays involving pharmacological inhibition of DOT1L, we used pinometostat at concentrations ranging from 1 μM to 5 μM (EPZ5676, Selleckchem S.7062).

Torre E.A., Arai E., Bayatpour S., Jiang C.L., Beck L.E., Emert B.L., Shaffer S.M., Mellis I.A., Fane M.E., Alicea G.M., Budinich K.A., Weeraratna A.T., Shi J, & Raj A. (2021). Genetic screening for single-cell variability modulators driving therapy resistance. Nature genetics, 53(1), 76-85.

+ Open protocol

+ Expand

Culturing Leukemic and 293T Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Leukemic cell lines (OCI-AML3, OCI-AML2, K562, NB4, HL-60, THP-1, U937 and KG-1) were cultured in RPMI-1640 medium (Invitrogen, Grand Island, USA) supplemented with 10% FBS (Invitrogen, Grand Island, USA), and 293T cells were grown in DMEM (Invitrogen, Grand Island, USA) supplemented with 10% FBS. MEF cells were cultured in DMEM/F12 (Invitrogen, Grand Island, USA) supplemented with 20% FBS. All cell lines were obtained from the Shanghai Institute of Hematology. EPZ004777 and EPZ5676 were purchased from Selleck Chemicals (Houston, TX, USA).

Zhang W., Zhao C., Zhao J., Zhu Y., Weng X., Chen Q., Sun H., Mi J.Q., Li J., Zhu J., Chen Z., Pandolfi P.P., Chen S., Yan X, & Xu J. (2018). Inactivation of PBX3 and HOXA9 by down-regulating H3K79 methylation represses NPM1-mutated leukemic cell survival. Theranostics, 8(16), 4359-4371.

+ Open protocol

+ Expand

Inhibitors Modulate NF-κB and IRF Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols

HCT116-Dual cells were treated with DMSO or inhibitors (500 nM). After a 48-h incubation, NF-κB activation was determined using QUANTI-Blue (InvivoGen; cat #rep-qbs), a secreted alkaline phosphatase detection reagent, by reading the OD at 655 nm. IRF activation was determined by measuring the relative light units in a luminometer using QUANTI-Luc (InvivoGen; cat #rep-qlc1).
The inhibitors of ABT-263/cat #S1001, AZD2014/cat #S2783, ABT737/cat #S1002, irinotecan HCl trihydrate/cat #S2217, RO-3306/cat #S7747, AZD5363/cat #S8019, BKM120/cat #S2247, azacitidine/cat #S1782, GSK343/cat #S7164, crizotinib/cat #S1068, EPZ5676/cat #S7062, GSK2118436/cat #S2807, AZD8055/cat #S1555, BMN673/cat #S7048, GSKJ4 HCl/cat #S7070, JQ1/cat #S7110, AZD7762/cat #S1532, AZD6244/cat #S1008, LY3214996/cat #S8534, GSK1120212/cat #S2673, AZD1775/cat #S1525, and milciclib/cat #S2751 were purchased from Selleck Chemicals. The milciclib/cat #HY-10424, gefitinib/cat #HY-50895, UNC1215/cat #HY-15649, cisplatin/cat #HY-17394, vorinostat/cat #HY-10221, and A-485/cat #HY-10745 were from MedChemExpress.

Guo E., Xiao R., Wu Y., Lu F., Liu C., Yang B., Li X., Fu Y., Wang Z., Li Y., Huang Y., Li F., Wu X., You L., Qin T., Lu Y., Huang X., Ma D., Mills G.B., Sun C, & Chen G. (2021). WEE1 inhibition induces anti-tumor immunity by activating ERV and the dsRNA pathway. The Journal of Experimental Medicine, 219(1), e20210789.

+ Open protocol

+ Expand

Targeting DOT1L and HMGA2 in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Y79 and Weri-Rb1 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA), and maintained in RPMI-1640 containing 10% FBS and penicillin–streptomycin (Invitrogen, Carlsbad, CA, USA) with routine testing for mycoplasma. EPZ5676, MS-275, and ciclopirox (CPX) were purchased from Selleck (Houston, TX, USA). These drugs and etoposide (Sigma, St. Louis, MO, USA) were dissolved in dimethyl sulfoxide (DMSO). When cells were treated with drugs for a longer time up to 8 days, drugs were replenished every two days under nonsaturating culture conditions. Adenoviruses for HMGA2 expression (VH893703) were purchased from Viagene Biosciences (Rockville, MD, USA). Lentiviral knockdown for DOT1L and HMGA2 was performed using the TRC lentiviral shRNA clones from Horizon Discovery (St. Louis, MO, USA) and the mature antisense sequences are as follows:
shDOT1L #210: TTGTTTAGCTTCTTCTTGCGG
shDOT1L #211: ATAGCGAGCTTGAGATCCGGG
shDOT1L #213: TAGCTCCACAATGCTGATCTG
shHMGA2 #965: TTCTGAACAACTTGTTGTGGC
shHMGA2 #966: TTGAGCTGCTTTAGAGGGACT

Mao Y., Sun Y., Wu Z., Zheng J., Zhang J., Zeng J., Lee C, & Kim J.K. (2021). Targeting of histone methyltransferase DOT1L plays a dual role in chemosensitization of retinoblastoma cells and enhances the efficacy of chemotherapy. Cell Death & Disease, 12(12), 1141.

+ Open protocol

+ Expand

Clonogenic Assay for Drug Sensitivity

Check if the same lab product or an alternative is used in the 5 most similar protocols

For long-term clonogenic assays, cells were counted and plated in low density in six-well plates and treated with different concentrations of EPZ004777 (Epizyme) or EPZ5676 (Selleckchem). After 12 days, colonies were fixed and stained with crystal violet and photographed. To assess cell viability, cells were plated in 10 cm culture dishes and treated with DMSO control or EPZ for 10 days. Media was replenished every 3–4 days. On day 10, cells were trypsinized, counted and replated in 96-well plates (5000 cells per well). On day 12, viability was assessed using the CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega) as per manufacturer’s instructions.

Vatapalli R., Sagar V., Rodriguez Y., Zhao J.C., Unno K., Pamarthy S., Lysy B., Anker J., Han H., Yoo Y.A., Truica M., Chalmers Z.R., Giles F., Yu J., Chakravarti D., Carneiro B, & Abdulkadir S.A. (2020). Histone methyltransferase DOT1L coordinates AR and MYC stability in prostate cancer. Nature Communications, 11, 4153.

+ Open protocol

+ Expand

Screening Proliferation-Modulating Factors in Leukemia

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cas9-expressing MLL-AF9 cells were virally transduced with the designated constructs (RFP⁺ ipUSEPR lentiviral sgRNA constructs listed in Supplementary Fig. 6; YFP⁺ MIY retroviral DOT1L variant cDNA constructs listed in Supplementary Fig. 9) in 96-well plates at ~50% infection and monitored using flow cytometry for RFP or YFP (FP). At each time point, live cell counts and the percentage of FP⁺ cells (FP%) were obtained by high-throughput flow cytometry and 4′,6-diamidino-2-phenylindole (Invitrogen) dye exclusion using an Attune NxT flow cytometer with an autosampler (Thermo Fisher).
The relative proliferation (RP) of FP⁺ (sgRNA- or DOT1L cDNA-expressing) vs. FP⁻ (non-transduced) cells was defined as:

Relative proliferation (RP) = \frac{[N (t) \times FP % (t)] \times [N (d 3) \times (100 - FP % (d 3))]}{[N (d 3) \times FP % (d 3)] \times [N (t) \times (100 - FP % (t))]}

where N(t) and FP%(t) are the observed live cell number and FP⁺% at time point t; d3 denotes the day 3 time point.
The resistance index was defined as:

Resistance index = \frac{RP (x, m)}{RP (con, m)} \times 100 %

where RP(x,m) is the RP of cells expressing sgRNA or DOT1L cDNA variant x under m µM of EPZ5676 (Selleck Chemicals) on day 9; con denotes the sg-Luc or wild-type DOT1L cDNA.

Yang L., Chan A.K., Miyashita K., Delaney C.D., Wang X., Li H., Pokharel S.P., Li S., Li M., Xu X., Lu W., Liu Q., Mattson N., Chen K.Y., Wang J., Yuan Y.C., Horne D., Rosen S.T., Soto-Feliciano Y., Feng Z., Hoshii T., Xiao G., Müschen M., Chen J., Armstrong S.A, & Chen C.W. (2021). High-resolution characterization of gene function using single-cell CRISPR tiling screen. Nature Communications, 12, 4063.

+ Open protocol

+ Expand

Selective CD117+ Bone Marrow Cell Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CD117 positive selection of bone marrow (BM) cells was performed using magnetic CD117 microbeads (Miltenyi 130-091-224) following the manufacturer’s instructions. The CD117 positive fractions were cultured in medium (Stemspan+100 ng/mL SCF+100 ng/mL TPO) and treated with JQ1 500 nM, EPZ-5676 1uM, BAY 1143572 400 nM for 24 and 48 hours (h). The inhibitors were from the following companies: JQ1 (Sigma-Aldrich, SML0974), EPZ-5676 (Selleckchem, S7062), BAY 1143572 (MedChem Express, HY-12871).
Details of the methods used are available in the Online Supplementary Appendix.

Zhou Y., Yan X., Feng X., Bu J., Dong Y., Lin P., Hayashi Y., Huang R., Olsson A., Andreassen P.R., Grimes H.L., Wang Q.F., Cheng T., Xiao Z., Jin J, & Huang G. (2018). Setd2 regulates quiescence and differentiation of adult hematopoietic stem cells by restricting RNA polymerase II elongation. Haematologica, 103(7), 1110-1123.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!