The largest database of trusted experimental protocols

On targetplus non targeting control sirna

Manufactured by Horizon Discovery
Sourced in United States, United Kingdom

ON-TARGETplus Non-targeting Control siRNA is a non-targeting small interfering RNA (siRNA) designed to serve as a negative control for siRNA experiments. It is a double-stranded RNA molecule that does not target any known mammalian genes.

Automatically generated - may contain errors

40 protocols using on targetplus non targeting control sirna

1

Transfection and Stimulation of Primary RPE Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human primary RPE cells were plated in 12-well plates and transfected with ON-TARGETplus Human PRKAA1 siRNA- SMARTpool, (L-005027-00-0005) and ON-TARGETplus Human PRKAA2 siRNA- SMARTpool, (L-005361-00-0005) or ON-TARGETplus Non-targeting control siRNA, (D-001810-01-05) from Dharmacon (Lafayette,CO,USA) utilizing Lipofectamine RNAiMAX (Invitrogen by Thermo Fisher Scientific,13778) according to the manufacturers protocol. Medium was changed after 24hours. On day 3 medium changed with fresh serum free medium for 24 hours and then treatment with acadesine (2mM) and/or TNF-α (10ng/ml) followed accordingly for another 24 hours. Then culture supernatants collected and lysates processed as previously.
+ Open protocol
+ Expand
2

PARG Silencing in Pancreatic Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MIA PaCa-2 and PANC cells were transfected with custom-made modified control and PARG siRNA oligonucleotides (Genisphere LLC, Hatfield, PA; PARG sense 5’-UACCAGAGCAGUUUAGUAA-3’). Transfections with unmodified ON-TARGET plus Non-targeting Control siRNA (GE Dharmacon, #D-001810–01-05) and ON-TARGET plus PARG siRNA (GE Dharmacon, # LU-011488–00-0002) were used as controls. All transfections were performed using 30nM of oligonucleotides and Lipofectamine 2000 (Life Technologies, #11668) according to manufacturer’s instructions.
+ Open protocol
+ Expand
3

PHGDH Gene Silencing with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
ON-TARGETplus Non-targeting control siRNA (D-001810-01-05) and SMARTpool ON-TARGETplus siRNA oligonucleotides targeting human PHGDH (L-009518-00) were purchased from Dharmacon. siRNA transfections were performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocol. Experiments were performed 72 h post transfection.
+ Open protocol
+ Expand
4

Evaluating GPNMB/OA Effects on Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Eagle's minimum essential medium (EMEM), Transwell inserts, phosphate buffered saline (PBS), and dimethyl sulfoxide (DMSO), CyQuant assay kit were obtained from Fisher Scientific (Pittsburg, PA). Cell culture plates (6, 24, and 96 wells) were obtained from USA Scientific (Ocala, FL). The following were obtained from Sigma Aldrich (St. Louis, MO): Bovine serum albumin (BSA) Dulbecco's modified eagle medium (DMEM), thiazolyl blue tetrazolium bromide (MTT), 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI), Bovine serum albumin, and penicillin/streptomycin. Fetal bovine serum (FBS) was acquired from Atlanta Biologicals (Lawrenceville, GA). Dharmafect 1 transfection reagent, OA siRNA (ON-TARGETplus SMARTpool), and non-targeting (scrambled) siRNA (ON-TARGETplus non-targeting control siRNA) were obtained from G.E. Dharmacon (Lafayette, CO). Recombinant GPNMB/OA (rOA), ELISA kits (human OA, murine OA) were obtained from R & D Systems (Minneapolis, MN). A selective RGD (Arg-Gly-Asp) blocking peptide was purchased from Peptides International, Louisville, KY.
+ Open protocol
+ Expand
5

siRNA-Mediated Knockdown Optimization in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA oligonucleotides used for knockdown experiments were transfected with INTERFERin (PolyPlus, 409-50), according to the manufacturer's instructions. Sequences of custom oligonucleotides were as follows: sihSnd2, CUAUAGGGUCGUUGAAUAATT (Haßdenteufel et al., 2017 (link)), siWRB, AAAUCCAACAGGUAAUUCCAACACC (Rivera-Monroy et al., 2016 (link)), siSRα, GAGCUUGAGUCGUGAAGAC (validated internally). The ON-TARGETplus Non-targeting Control siRNA was obtained from Dharmacon (D-001810-0X) and siTRC40 was from Abnova (H00000439-R02). Knockdowns were performed using single rounds of 48 h siRNA transfection in HeLa M cells and subsequent transfections of plasmid DNA encoding proteins of interest were performed 24 h post-siRNA transfection.
+ Open protocol
+ Expand
6

Investigating the Role of UCA1 in KSHV-Infected Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
wtKSHV-infected or uninfected TIVE cells were plated in 96-well plates (20,000 cells/well for MTS assay) and 48-well plates (250,000 cells/well for wound healing assay). Uninfected and wtKSHV-infected iSLK cells were plated in 96-well plates (8000 cells/well for MTS assay). siRNAs (5nM or 10 nM) against UCA1 (Qiagen) were transfected using Lipofectamine RNAiMAX reagent (ThermoFisher) according to the manufacturer’s protocol. ON-TARGETplus Non-targeting Control siRNA (Dharmacon) was used as the scrambled negative control. At 4 h post-transfection, the serum free medium was replaced by complete Medium-199 (TIVE) or DMEM (iSLK). Comparable transfection efficiencies were ensured by co-transfection of siGLO (Dharmacon).
+ Open protocol
+ Expand
7

Trophoblast Cell Line Maintenance and Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human trophoblast cell line HTR8/SVneo was maintained as described25 (link). Additional human trophoblast cell line Sw.71 was kindly provided by Dr. Gil Mor (Yale University), and maintained as described previously29 (link). In siRNA experiments, cells were transfected with the siRNAs (ThermoFisher) shown in Online Supplemental Materials and Methods using siPORT Amine transfection reagent as previously described24 (link). Control siRNA was purchased from GE Dharmacon (ON-TARGETplus Non-targeting Control siRNA). For reconstitution experiments, cells were first transfected with siRNA targeting endogenous ApoER2, and subsequently the cells were transfected with adenoviral particles (1010 particles/ml) encoding ApoER2 constructs24 (link). Twenty-four hours after adenoviral transfection, experiments were performed. Pharmacological inhibition studies were performed using HIF1α inhibitor (1μM, GN44028, TOCRIS), MMP14 inhibitor (10nM, NSC405020, Sigma-Aldrich), or p38 inhibitor SB 202190 (10 μM, Selleckchem) in the presence of NHIgG or aPL (100 μg/ml).
+ Open protocol
+ Expand
8

Knockdown of Rab27a and Slp2-a in Schwann Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Schwann cells were transfected with siRNA using Lipofectamine™ RNAi MAX complexes (Invitrogen) at 4 or 5 days post-purification. ON-TARGET plus Non-targeting control siRNA (catalog D-0018100-01-20, GE Dharmacon, Lafayette, CO, USA) served as the control. The siRNA primer sequences for Rab27a and siRNA Slp2-a are listed in Table 2.
+ Open protocol
+ Expand
9

Silencing β-dystrobrevin in NT2/D1 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The β-dystrobrevin gene was silenced with β-DB-synthetic small interfering ribonucleic acids (β-DB-siRNA; SMARTpool, ON-TARGETplus DTNB siRNA from Dharmacon). 1,5x106 NT2/D1 cells were transfected with 50 nM of β-DB-siRNA, or an equal amount of non-targeting control siRNA (c-siRNA; ON-TARGETplus Non-targeting Control siRNA from Dharmacon) using lipofectamine according to the manufacturer's instruction. Two days after transfection, cells were in part harvested for mRNA and protein extraction to assess β-dystrobrevin and synapsin I expression by real time PCR and Western blot analysis; the remaining cells were maintained in culture and induced to proliferate and differentiate by RA treatment analysis. Day 2 RA-treated-transfected cells were also in part harvested for protein extraction and Western blot analysis of β-dystrobrevin protein expression.
+ Open protocol
+ Expand
10

Silencing HOXA5 in HCT116 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Eight different small interfering RNAs (siRNAs; QIAGEN or Dharmacon, Lafayette, CO, USA) were used, each targeting different sequences within the respective HOXA5 transcripts (Additional file 1: Table S1 and Additional file 2: Figure S1). AllStars Negative Control siRNA (QIAGEN) or ON-TARGETplus Non-targeting Control siRNA (Dharmacon) was used as control siRNA. HCT116 cells were treated with the indicated siRNAs at a final concentration of 10 nM using Lipofectamine RNAiMax (Invitrogen) according to the manufacturer’s instructions. For the rescue experiments, after HCT116 cells were treated with HOXA5 siRNA #2 or control siRNA for 24 h, a plasmid containing HOXA5-encoding cDNA was transfected into the HCT116 cells using X-tremeGENE HP DNA Transfection Reagent (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer’s instructions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!