AgNO3, bacterial culture materials, and catalase (CAT) and glutathione peroxidase (GPx) enzymes were purchased from Sigma-Aldrich (St. Louis, MO, USA). Other reagents were purchased from the following companies: LDH Assay Kit (colorimetric) from Abcam (Cambridge, UK); PiBind resin from Expedeon (San Diego, USA); TRIzol reagent from Life Technologies (California, USA); Maxima SYBR Green/Fluorescein qPCR Master Mix and QuantiTects Reverse Transcription Kit from Qiagen (Germantown, USA); and TriFast from Peqlab VWR (Pennsylvania, USA).
Maxima sybr green fluorescein qpcr master mix
Manufactured by Qiagen
Sourced in United States
Maxima SYBR Green/Fluorescein qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains SYBR Green I dye and fluorescein as a passive reference dye, along with all the necessary components for efficient and sensitive qPCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Rotor gene q, by Qiagen (5 mentions)
Quantitect reverse transcription kit, by Qiagen (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Quantitects reverse transcription kit, by Qiagen (2 mentions)
Pibind resin, by Abcam (2 mentions)
Maxima sybr green fluorescein master mix, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Glutathione peroxidase, by Merck Group (1 mentions)
Ldh assay kit, by Abcam (1 mentions)
Agno3, by Merck Group (1 mentions)
Silver nitrate agno3, by Merck Group (1 mentions)
Primer express 3, by Thermo Fisher Scientific (1 mentions)
7 protocols using maxima sybr green fluorescein qpcr master mix
1
AgNO3 Oxidative Stress Assay
2
Fungal-Mediated Synthesis of Silver Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Silver nitrate (AgNO3), fungal culture medium, and enzyme activity assay kits (colorimetric; catalase [CAT], and glutathione peroxidase [GPx] were obtained from Sigma-Aldrich (St. Louis, MO, USA), while lactate dehydrogenase [LDH]) from Abcam (Cambridge, UK). PiBind resin was purchased from Expedeon (San Diego, CA, USA); TRIzol reagent was obtained from Life Technologies (Carlsbad, CA, USA); Maxima SYBR Green/Fluorescein qPCR Master Mix and the QuantiTects Reverse Transcription Kit was obtained from Qiagen (Germantown, MD, USA); and TriFast was purchased from Peqlab VWR (Radnor, PA, USA). The silver nanoparticles were previously synthesized by our team using Desertifilum sp. IPPAS B-1220 (D-SNPs) and Nostoc sp. Bahar_M (N-SNPs); their physicochemical properties were analyzed by ultraviolet–visible (UV–Vis) spectrophotometry, X-ray diffraction, Fourier-transform infrared (FTIR) spectroscopy, and scanning (SEM) and transmission electron microscopy (TEM). The D-SNP and N-SNP particle size ranged from 4.5 to 26 nm and 8.5 to 26.4 nm, respectively, with an average diameter of 14.7 ± 1.1 nm and 14.9 ± 0.5 nm, respectively [33 (link),34 (link)].
3
Rat Hepatic Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNeasy Mini kit (Qiagen, U.S.A.) was used to separate the RNA content of rat hepatic cells. Maxima® SYBR Green/Fluorescein Master Mix (Fermentas, U.S.A.) was used to evaluate the total RNA amount. One microgram of RNA was reverse transcribed into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen, U.S.A.). PGC-1, TFAM, mTOR, cyclin D1, Nrf2, HO-1, and PCNA mRNA levels in rat hepatic lysate were determined using Maxima® SYBR Green/Fluorescein qPCR Master Mix by Rotor-Gene Q (Qiagen, U.S.A.). Moreover, rat β-actin was used as a housekeeping gene and internal reference control. The work was done using Applied Biosystem StepOne Plus, Foster City, CA, U.S.A. The gene specific PCR primers used were summarized in Table 1 .
The primers set used for detection of gene expression in rats.
| Gene symbol | Primer sequence from 5′-3′ | Gene bank accession number |
|---|---|---|
| β-actin | F: TCCGTCGCCGGTCCACACCC | NM_031144.3 |
| PGC-1 | F: ACATCGCAATTCTCCCTT | XM_032916070.1 |
| TFAM | F: AATGTGGGGCGTGCTAAGAA | NM_031326.2 |
| mTOR | F: CTGCACTTGTTGTTGCCTCC | NM_019906.2 |
| Cyclin D1 | F: TCGACGGCCATTACCAATCG | X75207.1 |
| PCNA | F: AGTTTTCTGCGAGTGGGGAG | NM_022381.3 |
| Nrf2 | F: 5′-CTCTCTGGAGACGGCCATGACT-3′ | NM_031789 |
| HO-1 | F: 5′-CACCAGCCACACAGCACTAC-3′ | NM_012580 |
4
RT-qPCR Analysis of Antibiotic Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This experiment evaluated the expression levels of penicillin-binding protein PBP 2A in Staphylococcus aureus (ATCC 25923) and gyrase B in Pseudomonas aeruginosa (ATCC 29853) using RT-qPCR analysis.
Bacteria were grown following the protocol of MIC determination in the presence and absence of P. crispa HF fraction. Total RNA was extracted from the harvested bacteria using TRIzol reagent (15596018, Invitrogen, Carlsbad, CA, USA) and purified according to the manufacturer’s instructions. The RNA was then reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Germantown, MD, USA) with gene-specific PCR primers for PBP 2A and gyrase B (Table 6 ). The resulting cDNA and a negative control were subjected to amplification using Maxima SYBR Green/Fluorescein qPCR Master Mix and Rotor-Gene Q (Qiagen, Germantown, MD, USA), and the housekeeping amplicon used was β-actin. The relative gene expression fold change was determined using the ΔΔCt method based on at least three independent RNA samples. The thermal cycling conditions followed the protocol established by Lanoix et al., 2006 [28 (link)]. The relative expression levels of the target genes were estimated using the 2−∆∆ct method, and the fold changes were calculated accordingly.
Bacteria were grown following the protocol of MIC determination in the presence and absence of P. crispa HF fraction. Total RNA was extracted from the harvested bacteria using TRIzol reagent (15596018, Invitrogen, Carlsbad, CA, USA) and purified according to the manufacturer’s instructions. The RNA was then reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Germantown, MD, USA) with gene-specific PCR primers for PBP 2A and gyrase B (
5
Quantitative Analysis of Nrf2 Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The procedure was conducted as described previously by our group [23] [24] [25] . Briefly, total RNA was extracted using an RNeasy Mini kit (Qiagen, USA), and the concentration was evaluated with a Maxima® SYBR Green/Fluorescein Master Mix (Fermentas, USA). Then, 1 µg RNA was reverse transcribed into cDNA by a QuantiTect® Reverse Transcription Kit (Qiagen, USA). The expression levels of Nrf2, HO-1, ERK5, PKCδ, ADAMTS-4, aggrecans, MMP3, and VEGF mRNA in rat hepatic lysates were measured with Maxima® SYBR Green/Fluorescein qPCR Master Mix and Rotor-Gene Q (Qiagen, USA). Finally, for housekeeping and internal referencing, rat glyceraldehyde 3-phosphate dehydrogenase Table 1. Primer Sequences for real-time PCR assay.
6
Gene Expression Analysis in Rat Hepatic Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression of total AKT, total Src, and caspase-3 in different rats' hepatic tissues was determined using Maxima SYBR Green/Fluorescein qPCR Master Mix by Rotor-Gene Q (Qiagen, Hilden, Germany). Rat glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene and an internal reference control. Gene-specific polymerase chain reaction (PCR) primers were designed using Primer Express 3.0 (Applied Biosystems, Foster City, CA, USA) according to the nucleotide sequence obtained from the Gene Bank. Thermal cycling conditions included initial activation step at 95°C for 10 min followed by 30-40 cycles of 94°C for 15 s, 55°C or 58°C for 30 s, and 72°C for 1 min. The primer sequences, amplicon size, and annealing temperatures used for amplification are listed in Table 1. Melting curve analysis of the PCR products was performed to verify their specificity and identity. Rotor-Gene Q (Qiagen) collected data automatically and analyzed the value of threshold cycle (Ct). Rat total AKT, total Src, caspase-3, and GAPDH messenger RNA (mRNA) relative expression were determined using 2 -ΔΔCt method. PCR products were confirmed by running on 1.2% agarose gel electrophoresis.
7
Quantitative RT-qPCR of Rabbit PAH Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-qPCR was applied to detect PAH gene expression after feeding rabbits (O. cuniculus) on dry and fresh beans. Gene expression was determined using Maxima SYBR Green/ Fluorescein qPCR Master Mix by Rotor-Gene Q (Qiagen, USA) using a two-step cycling protocol and glyceraldehyde-3-phosphate as a housekeeping gene. TRIzols reagent (15596026, Life Technologies, USA) was applied for total RNA purification from liver samples. Yield and quality of total RNA were determined spectrophotometrically at 260 and 260/280 nm ratios, respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!