Native bladders (n = 4) and decellularized tissues (n = 4 for each group) were dabbed dry with tissue paper and weighted (Wu et al., 2011 (link)). According to the manufacturer’s instructions, the total genomic DNA in wet samples was extracted by a Genomic DNA Kit (Tiangen, China). DNA content was measured using a Nanodrop ND3300 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States). The DNA quantity was express as ng/mg wet weight of the samples.
Nanodrop nd 3300
Manufactured by Thermo Fisher Scientific
Sourced in United States
The NanoDrop ND-3300 is a spectrophotometer designed for the quantification and qualification of nucleic acids and proteins. It utilizes a unique sample-retention technology that requires only 1-2 microliters of sample to perform measurements. The instrument can detect a wide range of concentrations and provides accurate results across a broad linear dynamic range.
Automatically generated - may contain errors
Lab products found in correlation
Genomic dna kit, by Tiangen Biotech (1 mentions)
Quant it picogreen dsdna assay kit, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Merck Group (1 mentions)
Transstart top green qpcr supermix dye 2, by Transgene (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Goscript reverse transcription system, by Promega (1 mentions)
Abi q5 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Rna 6000 pico chip, by Agilent Technologies (1 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (1 mentions)
Taqman advanced mirna assay, by Thermo Fisher Scientific (1 mentions)
Taqman advanced mirna cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rna isolation kit, by Thermo Fisher Scientific (1 mentions)
6 protocols using nanodrop nd 3300
1
Quantifying DNA Content in Bladder Tissues
2
Validating CTCF ChIP-seq Findings
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Our CTCF ChIP-seq results were confirmed via ChIP-PCR. Briefly primers of approximately 150 bp were constructed to cover regions that were sequenced in the ChIP-seq experiment, and amplified with SYBR Green (Millipore, Upstate Biotechnology, Inc. Lake Placid, NY, USA). DNA of SKOV3 cells was quantified on a nanodrop ND3300 (Thermo Scientific, Waltham, MA) using a Quant-iT Picogreen dsDNA Assay Kit (Invitrogen), and equal quantities of DNA were used as template. Comparison of input, CTCF and IgG pulldowns are reported as the average according to the manufacturer’s protocol (Millipore, Upstate Biotechnology, Inc.). For a complete list of the primers used to amplify those regions see Supplementary Table 4 .
3
Quantitative Analysis of miR-7-5p in Glioma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from glioma tissues and cell lines was extracted using TRIzol Reagent (Invitrogen) according to the manufacturer’s protocols, and 1 μg of RNA quantified by a NanoDrop ND-3300 (Thermo Fisher Scientific) was reverse transcribed using GoScript Reverse Transcription System (Promega) with corresponding primers. Real-time PCR analyses were performed with TransStart Top Green qPCR SuperMix (+Dye II) (TransGen) on an ABI Q5 Sequence Detection system (Applied Biosystems); GAPDH was used as an internal control. Bulge-Loop miRNA-specific Primer (RiboBio) was applied to measure miR-7-5p expression according to the manufacturer’s synopsis, and U6 was used as an endogenous control. Relative mRNA and miRNA expression levels were analyzed using the 2-ΔΔCt method. All primers were synthesized by Sangon Biotech; detailed information is shown in Table S1 .
4
Microsatellite Genotyping of Hair Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from hair samples following the standard instructions described for the Qiagen DNeasy Blood and Tissue Kit used. Each DNA sample was then quantified using a NanoDrop ND-3300 fluorospectrometer device (Thermo Scientific; Waltham, MA, United States).
The genotyping analysis was performed with 15 μL of template DNA using the multiplex kit of 12 microsatellite markers and the PCR protocol developed by Spanoghe et al. (2022) (link). The fragment lengths of the PCR products were estimated with the GeneMapper Software 6.0 (Applied Biosystems). They were then used to construct a genotypic dataset for statistical analyses.
The genotyping analysis was performed with 15 μL of template DNA using the multiplex kit of 12 microsatellite markers and the PCR protocol developed by Spanoghe et al. (2022) (link). The fragment lengths of the PCR products were estimated with the GeneMapper Software 6.0 (Applied Biosystems). They were then used to construct a genotypic dataset for statistical analyses.
5
Quantitative Profiling of EV-Associated miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As input for reverse transcription of cDNA, 5 ng of cellular RNA and corresponding EV-RNA was used (determined by Nanodrop ND3300 using the RiboGreen Assay for RNA quantitation (Thermo Fisher Scientific)). In case of EVs harvested in presence or absence of NS21, equal input of 1.7 ng EV-RNA was used (determined by Bioanalyzer, RNA 6000 Pico Chip (Agilent)). As RNA was below the detection limit in samples derived from media and media supplements, the maximal input volume of 3.7 µl of RNA was included in the cDNA synthesis reaction of these samples. A spike-in of cel-miR-39-3p (UCACCGGGUGUAAAUCAGCUUG, 0.994 amol) was added to each RNA-sample as a control later used for normalization and inter-sample calibration of qPCR results. cDNA synthesis was carried out using the TaqMan Advanced miRNA cDNA Synthesis Kit (Thermo Fisher Scientific). For RT-qPCR, TaqMan Fast Advanced Master Mix and TaqMan Advanced miRNA Assays detecting miR-122-5p, miR-451a, miR-30d-5p, let-7g or cel-miR-39-3p (Thermo Fisher Scientific) were used. RT-qPCR was performed with the StepOne Real-Time PCR System (Applied Biosystems).
6
Quantitative PrP Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the CSF samples using an RNA isolation kit (Ambion Inc., Austin, TX, USA) according to the manufacturer instructions. RNA concentration and purity were determined using a NanoDrop ND-3300 fluorospectrophotometer (Thermo, Grass Valley, CA, USA). First strand cDNA was then synthesized using RNA as the template, followed by reverse transcription PCR (RT-PCR) using specific primers for PrP (forward, 5'-GUG CAC GAC UCA AUA TA-3'; reverse, 5'-TTC ACG UGC UGA CGC AG-3') in a fluorescent PCR reactor (ABI, Vernon, CA, USA). The reaction conditions were: pre-denaturing at 94°C for 1 min, followed by 30 cycles of denaturing at 94°C for 1 min, annealing at 60°C for 1 min, and elongation at 72°C for 3 min. The relative expression level was calculated using the 2 -DDCt method. Parallel controlled reactions were performed for the b-actin gene (forward, 5'-GGT GTG ATG GTG GGT ATG GGT-3'; reverse, 5'-CTG GGT CAT CTT TTC ACG GT-3').
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!