For BVDV antigen detection, 5-μm-thick paraffin-embedded tissue sections were deparaffinized and hydrated through a graded alcohol series before heat-induced antigen retrieval in 10 mM sodium citrate buffer (pH 6) for 30 min. A primary anti-BVDV monoclonal antibody (DMAB28412; Creative Diagnostics, Shirley, NY, USA) was used according to the manufacturer’s instructions. Next, the tissue sections were stained with a biotinylated anti-mouse IgG antibody (Vector Laboratories, Inc., Burlingame, CA, USA) for 1 h at room temperature, washed, and incubated with the VECTASTAIN ABC Reagent (Vector Laboratories) for 30 min. After washing, the tissue sections were allowed to react with a peroxidase substrate solution (Vector), rinsed, counterstained, mounted, examined by light microscopy, and photographed. Negative control slides were prepared by staining with isotype-matched IgG at the same dilution as that used for the primary antibody.
Biotinylated anti mouse igg antibody
Manufactured by Vector Laboratories
Sourced in United States
The Biotinylated anti-mouse IgG antibody is a laboratory reagent used to detect and quantify mouse immunoglobulin G (IgG) in various immunoassay applications. The antibody is conjugated with biotin, which enables its detection and signal amplification when used in conjunction with streptavidin or avidin-based detection systems.
Automatically generated - may contain errors
Lab products found in correlation
3 3 diaminobenzidine (dab), by Thermo Fisher Scientific (5 mentions)
Eclipse e200, by Nikon (5 mentions)
Hematoxylin, by Muto Pure Chemicals (5 mentions)
Vectorstain elite, by Vector Laboratories (3 mentions)
Axiovision 4, by Zeiss (3 mentions)
Anti mouse cd31 antibody, by BD (3 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (3 mentions)
Vectastain abc reagent, by Vector Laboratories (2 mentions)
Proteinase k, by Worthington (2 mentions)
3 3 diaminobenzidine (dab), by Vector Laboratories (2 mentions)
Zen 2, by Zeiss (2 mentions)
Bz x700, by Keyence (2 mentions)
Alexa fluor 488, by Thermo Fisher Scientific (2 mentions)
Goat anti mouse igg, by Thermo Fisher Scientific (2 mentions)
Bz x analyzer software, by Zeiss (2 mentions)
Peroxidase substrate solution, by Vector Laboratories (1 mentions)
Abc elite, by Vector Laboratories (1 mentions)
Tween 80, by Thermo Fisher Scientific (1 mentions)
Gill s hematoxylin, by Thermo Fisher Scientific (1 mentions)
Vectastain elite abc kit, by Vector Laboratories (1 mentions)
25 protocols using biotinylated anti mouse igg antibody
1
BVDV Antigen Detection in Tissues
2
Immunohistochemical Analysis of Amyloid Plaques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse brains were fixed with 4% paraformaldehyde in PBS for 24 h, dehydrated and embedded in paraffin. Serial sections were cut at 4-μm thickness. Deparaffinized sections were treated with microwave (700 W) in citrate buffer pH 6.0 for 18 min, followed by digestion with 100 μg/ml proteinase K (Worthington) in TBS for 6 min at 37 °C. After blocking by incubation with 10% calf serum in TBS, the sections were incubated with an anti-Aβ antibody 82E1 (IBL) and then a biotinylated anti-mouse IgG antibody (Vector Laboratories), followed by visualization by avidin-biotin complex method (ABC elite, Vector Laboratories) using diaminobenzidine as chromogen. The sections were lightly counterstained with hematoxylin. The amyloid plaque burden of the indicated brain area was measured using Image J software (NIH) as previously described [29 (link)].
3
Immunohistochemical Identification of Trophoblasts and Vascular Smooth Muscle Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trophoblast cells were identified by immunohistochemistry for cytokeratin using mouse monoclonal anticytokeratin antibody (DAKO) and the method described by Vercruysse et al. (2006) (link). Negative controls consisted of sections in which the primary antibody was substituted with an equal concentration of mouse IgG (DAKO).
Immunohistochemistry for α-actin was used to identify vascular smooth muscle cells. In brief, tissues were rehydrated using a graded ethanol series and sections were subsequently blocked using 10% normal horse serum (NHS) + 0.1% Tween-80 (Thermo Fisher Scientific) for 20 min followed by serum-free DAKO block for 7 min. Sections were then incubated for 30 min in the presence of antibody against smooth muscle α-actin (Sigma-Aldrich; 1:400 in 2% NHS); this was followed by incubation with biotinylated anti–mouse IgG antibody (1:200 in 1% NHS + 3% normal rat serum; 30 min; Vector Laboratories). A Vectastain ABC Elite kit (Vector Laboratories) and diaminobenzidine (DAKO) were used to detect antigenic sites. Tissues were counterstained with Gill’s hematoxylin (Thermo Fisher Scientific), dehydrated, and mounted. Negative controls consisted of sections incubated with an equal concentration of mouse IgG (DAKO) in place of the primary α-actin antibody.
Immunohistochemistry for α-actin was used to identify vascular smooth muscle cells. In brief, tissues were rehydrated using a graded ethanol series and sections were subsequently blocked using 10% normal horse serum (NHS) + 0.1% Tween-80 (Thermo Fisher Scientific) for 20 min followed by serum-free DAKO block for 7 min. Sections were then incubated for 30 min in the presence of antibody against smooth muscle α-actin (Sigma-Aldrich; 1:400 in 2% NHS); this was followed by incubation with biotinylated anti–mouse IgG antibody (1:200 in 1% NHS + 3% normal rat serum; 30 min; Vector Laboratories). A Vectastain ABC Elite kit (Vector Laboratories) and diaminobenzidine (DAKO) were used to detect antigenic sites. Tissues were counterstained with Gill’s hematoxylin (Thermo Fisher Scientific), dehydrated, and mounted. Negative controls consisted of sections incubated with an equal concentration of mouse IgG (DAKO) in place of the primary α-actin antibody.
4
Neurochemical Profiling of Dopamine Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Atropine sulfate, guanethidine monosulphate, Nω-nitro-L-argininemethylester, 6-hydroxy dopamine, and ascorbic acid were purchased from Sigma Chemicals Co. (St. Louis, MO, USA). Tetrodotoxin, Substance P, N-acetyl-L-tryptophan 3,5-bis (trifluoromethyl) benzyl ester, GR159897, and SB218795 were purchased from Tocris (Bristol, UK). Mouse anti-TH antibody (1:2000) was purchased from Chemicon International (Temecula, CA, USA). Biotinylated anti-mouse IgG antibody (1:1000) and nickel-intensified 3,3′-diaminobenzidine tetrahydrochloride (DAB Substrate Kit for peroxidase) were purchased from Vector Laboratories (Burlingame, CA, USA). Neutral-buffered formaldehyde (NBF) and xylene were purchased from Carlo Erba (Milan, Italy).
5
Immunohistochemical detection of Arc protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen coronal sections were washed in 0.05% Tween 20 in PBS 0.1 M (Wash Buffer solution), treated in 1% distilled H2O2 for 15 min and incubated in TNB (0,1 M Tris–HCl pH 7.5, 0,15 M NaCl and 0.5% Blocking Reagent; Perkin Elmer Life Sciences, Inc.) as a blocking solution. Sections were incubated in mouse Anti-Arc antibody (sc-166461, Santa Cruz Biotechnology, Inc.; Santa Cruz, CA, USA; diluted 1:50) for 48 h at 4 °C in a humidified chamber. Later the sections were washed and incubated in Biotinylated anti-mouse IgG antibody (Vector Laboratories Inc.; Burlingame, CA, USA; diluted 1:100) ON at 4 °C. Finally, samples were incubated in Streptavidin-peroxidase (Perkin-Elmer Life Sciences, Inc., diluted 1:100) for 2.5 h at room temperature and washed and incubated in DAB (Fisher) for 10 min. Lastly, sections were dehydrated, mounted and cover slipped. No staining was observed in control slides without the primary or secondary antibodies.
6
Immunohistochemical Detection of E. coli in Caecal Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to investigate the colonization and penetration of caecal tissues by E. coli, paraffin embedded samples of caeca from all birds were processed for immunohistochemistry. Further, to validate the findings from the actual study, caeca of 14 turkeys from infected groups with monoxenic (n = 8) or xenic (n = 6) cultures of H. meleagridis and control birds (n = 4) from previously published experiments were included [29 (link), 33 (link)]. Likewise, caecal samples of naturally infected turkeys showing severe fibrinous typhlitis from two field cases were also considered. The IHC protocol for the detection of E. coli was followed as described previously [4 (link)]. Briefly, tissue sections mounted on charged glass slides were dewaxed, rehydrated and incubated overnight with a primary monoclonal antibody (anti-E. coli LPS antibody (2D7/1), ab35654, Abcam, Austria). Following incubation, slides were washed with PBS and biotinylated anti-mouse IgG antibody (Vector Laboratories, Austria) was added. Then the vectastain ABC Kit and DAB substrate kit (Vector Laboratories) were used for visualizing the bound antibody. Finally, the sections were counter-stained with Mayer's haematoxylin (Merck KGaA, Austria) and observed under a microscope.
7
Immunohistochemical Analysis of Angiogenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice were sacrificed, and wounded skin tissues or gastrocnemius skeletal muscles were harvested, fixed with 4% PFA overnight at 4 °C, and followed by sucrose dehydration and OCT embedding 33 (link), 37 (link), 40 (link). Capillary density was determined in 5 μ m thick sections that were stained with anti-mouse CD31 antibody (BD Biosciences) followed by biotinylated anti-mouse IgG antibody (Vector Laboratories). For immunohistochemistry, we used R.T.U. Vectorstain Elite (Vector Laboratories) followed by DAB (Vector Laboratories). Immunofluorescence staining was performed with primary antibodies against, CD31 or αSMA. Secondary antibodies were Alexa Fluor 488 or 546-conjugated goat anti-rabbit IgG and goat anti mouse IgG (Invitrogen). In each experiment, DAPI (Invitrogen) was used for nuclear counter-staining. Images were taken using a fluorescence microscope (Keyence, BZ-X700) or an Axioscope microscope with a 20 objective. Microscopy images were acquired with axiovision 4.8.2 software, BZ-X Analyzer software and ZEN 2.3 software (Zeiss).
8
Immunohistochemical Analysis of Angiogenesis
9
In Situ Hybridization and Immunohistochemistry of Mouse DISC1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA fragments of mouse DISC1 were amplified by reverse-transcribed-PCR using the sense/antisense primer set of 5′- ATGCAGGGCGGGGGTCCCCGG -3′/5′-TCAGGCCTCGGTTTCCTGAG-3′, and used as templates for probe synthesis. Probe was hydrolyzed and in situ hybridization of coronal mouse brain sections with DIG-labeled RNA probes was performed as described previously [39] (link). The slides were washed thoroughly in PBS following a colorimetric reaction. Next, the slides were incubated overnight at 4°C with the primary antibody (monoclonal mouse anti-APC antibody) at 1∶50 in PBS. After washing in PBS, the slides were incubated for 30 min at RT with the secondary antibody (biotinylated anti-mouse IgG antibody from Vector Laboratories). After amplification with the avidin-biotin complex using ABC kit (Vector Laboratories), reaction products were visualized with 50 mM Tris-HCl buffer (pH 7.6) containing 0.02% diaminobenzidine tetrahydrochloride (Sigma) and 0.01% hydrogen peroxide. After dehydration, the sections were sealed using Entellan.
10
Histological Analysis of Wound Healing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice were sacrificed at 1–7 days after wounding, and skin tissues around wound edge were harvested and embedded in paraffin. Frozen sections were prepared by overnight 4% PFA incubation followed by sucrose dehydration and OCT embedding. 5-μmthick sections were stained with hematoxylin-eosin (HE), and Masson’s trichrome staining. To determine the Capillary density, wound tissue sections were stained with anti-mouse CD31 antibody (BD Biosciences) followed by biotinylated anti-mouse IgG antibody (Vector Laboratories). For other immunohistochemical analysis, skin sections were incubated with primary antibodies against Atox1, Mac-3 (BD Biosciences) and cyclin D1 (Abcam). This was followed by incubation with biotin-conjugated secondary antibody (Vector Laboratories) Next, we used R.T.U. Vectorstain Elite (Vector Laboratories) followed by DAB visualization (Vector Laboratories). Immunofluorescence staining was performed with primary antibodies against Atox1, CD31 (BD Biosciences), or Mac-3 (BD Biosciences). Secondary antibodies were Alexa Fluor 488 or 546-conjugated goat anti-rabbit IgG and goat anti mouse IgG (Invitrogen). In each experiment, TO-PRO-3 (Invitrogen) was used for nuclear counter staining. Images were captured by Axio scope microscope (Zeiss) or confocal microscopy (Zeiss) and processed by AxioVision 4.8 or LSM510 software (Zeiss).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!