Anti ncl

Cells were fixed in 1× PBS, 4% paraformaldehyde for 20 min and permeabilized for 10 min with 0.4% Triton X-100, 0.05% CHAPS. The EBNA1–digoxigenin probe mRNA (5′-CTTTCCAAACCACCCTCCTTTTTTGCGCCTGCCTCCATCAAAAA-3′) at 50 ng/well was denaturated for 5 min at 80°C. The probe hybridization reaction was carried out in 40 μl of hybridization buffer (10% formamide, 2× SCC, 0.2 mg/ml E. coli tRNA, 0.2 mg/ml salmon sperm DNA and 2 mg/ml BSA). The fixed cells were washed and blocked into the blocking solution (1× PBS, 3% BSA, 0.1% saponin) before incubation with the primary antibodies (anti-digoxigenin, Sigma 1/200 and anti-NCL, Abcam 1/1000). The PLA reaction was performed under the manufacturer’s protocol using the Duolink PLA in situ kit, PLA probe anti-rabbit plus, PLA probe anti-mouse Minus and the in situ detection reagent FarRed, all from Sigma. The results were analysed using a Zeiss Axio Imager M2. All the PLA experiments were performed at least three times independently, and the following controls probes were implemented: without mRNA probe or without primary antibodies.

Cells were fixed with 4% paraformaldehyde in PBS 1X for 20 min and permeabilized with 0.4% Triton X-100, 0.05% CHAPS for 5 min at room temperature. A quantity of 50 ng of EBNA1-digoxigenin mRNA probe (5′ CTTTCCAAACCACCCTCCTTTTTTGCGCCTGCCTCCATCAAAAA 3′) or control sense probe was denaturated 5 min at 80 °C and the hybridization reaction was carried out overnight at 37 °C in 40 μl hybridization buffer (10% formamide; 2X SSC, 0.2 mg ml^–1E. coli tRNAs, 0.2 mg ml^–1 sheared salmon sperm DNA and 2 mg ml^–1 BSA. A blocking solution of 3% BSA 0.1% saponine in 1X PBS was added for 30 min followed by 2 h incubation at room temperature with the primary antibodies (anti-digoxigenin 1/200 -Sigma- and anti-NCL 1/1000 -Abcam-) diluted in PBS 1X, 0.3% BSA, 0.1% saponine. The PLA was carried out using the Duolink PLA in situ kit, PLA probe anti-rabbit plus, the Duolink in situ PLA probe anti-mouse MINUS and the in situ detection reagent FarRed (all from Sigma) following the manufacturer’s protocol. PLA results were visualized using a Zeiss LSM780 confocal microscope. All the PLA experiments were performed at least three times independently and, each time, PLA dots were counted in 50–100 cells. For each PLA experiment, the following controls were used: w/o mRNA probe, w/o antibodies and with the control sense probe.

Cell lysates were prepared by washing cells with phosphate buffered saline (PBS), then lysed in Igepal lysis buffer (10mM Tris pH 7.5, 0.25M NaCl, 0.5% Igepal) supplemented with Complete™ protease inhibitor cocktail (Roche) at 4°C for 5 min, followed by clarification by centrifugation (3 min, 12,000 rpm). Supernatant was mixed with Laemmli sample buffer and boiled at 100°C, separated by SDS-PAGE and proteins transferred to polyvinylidene difluoride membrane (Immobilon-P, Millipore). Membranes were blocked in 5% milk in PBS/ 0.1% Tween-20, incubated with anti-HIF-1α (BD Transduction Laboratories, clone#610959), anti-NCL (abcam, clone# 22758), anti-NDRG1(Cell signaling, clone#5196) or anti-β-actin (Sigma, clone#A5441) primary antibodies and appropriate HRP-conjugated secondary Mouse antibodies (DAKO, clone#P0447) and Rabbit antibodies (Cytiva, clone#NA934V). Chemiluminescence substrate (West Dura, 34076, Thermo Fisher Scientific) was used to visualize proteins using a ChemiDoc XRS+ imaging system (BioRad). Densitometric analysis was performed using ImageJ software (NIH).