Total RNA was isolated from inflorescences (Arabidopsis) and petals (rapeseed) using Trizol (Bioteke, Beijing, China) according to the manufacturer’s instructions. DNase treatment was performed on total RNA to remove the genomic DNA contamination, and then the RNA was used for first strand cDNA synthesis using a SuperScript II kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol with an oligo(dT)18 primer. The derived cDNA was used as template for real-time RT-PCR analysis. Quantitative PCR was performed with SYBR Green Realtime PCR Master Mix (TOYOBO, Osaka, Japan). ACTIN mRNA was detected in parallel and controlled data normalization. The primers used for quantitative PCR are listed in Supplementary Table S1 .
Trizol
Manufactured by BioTeke
Sourced in China
TRIzol is a ready-to-use reagent for the isolation of total RNA, DNA, and proteins from a wide variety of biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components that facilitate the effective lysis of cells and the subsequent separation of the cellular components.
Automatically generated - may contain errors
Lab products found in correlation
Pcr mastermix, by Solarbio (2 mentions)
Sybr green, by Solarbio (2 mentions)
Aβ1 42, by Merck Group (2 mentions)
Sybr green master mix, by Solarbio (2 mentions)
Beyort 2 m mlv reverse transcriptase, by Beyotime (2 mentions)
Sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Superscript 2 kit, by Thermo Fisher Scientific (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Sybr premix ex taqtm 2 kit, by Takara Bio (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Beyoecl star, by Beyotime (1 mentions)
Steponeplus device, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr kit, by Solarbio (1 mentions)
Beyort 2 m mlv, by Beyotime (1 mentions)
Exicycler 96 instrument, by Bioneer (1 mentions)
Pioglitazone, by Merck Group (1 mentions)
Protein a sepharose beads, by Santa Cruz Biotechnology (1 mentions)
Rnase inhibitor, by BioTeke (1 mentions)
Ecl reagent, by Wanlei (1 mentions)
13 protocols using trizol
1
Quantitative RNA Expression Analysis
2
Quantifying PARP14 and Bone Loss in Spinal Cord Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative polymerase chain reaction (qPCR) was conducted to assess the mRNA expression level of PARP14 and bone loss-related genes. Total RNA was obtained from spinal cord tissues (injury site, 28 days post-injury), BV2 cells (1 × 106 cells per group), and bone tissues (obtained from femoral metaphysis at 28 days post-injury) using TRIzol (BioTeke, Beijing, China) and then reverse transcribed into complementary DNA using reverse transcriptase (BeyoRT II M-MLV system, Beyotime, Shanghai, China). The qPCR reaction was performed using PCR MasterMix (Solarbio) and SYBR Green (Solarbio). Primers were designed by GenScript (Beijing, China). β-Actin served as a loading control. Data were analyzed using the 2–ΔΔCt method (Livak and Schmittgen, 2001). The thermocycling conditions used for the qPCR reaction were as follows: 94°C for 5 minutes, 40 cycles of 94°C for 10 seconds, 60°C for 20 seconds, and 72°C for 30 seconds. The reaction components were as follows: cDNA template (1 µL), upstream (0.5 µL) and downstream (0.5 µL) primers, SYBR Green (0.3 µL), BeyoRT II M-MLV reverse transcriptase (10 µL), and ddH2O (7.7 µL). The sequences of the primers used for qPCR are shown in Additional Table 1
3
Quantitative Transcriptome Analysis of U87 and U251 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from U87 and U251 cells was extracted using TRIzol (RP2401, BioTeKe Corporation). RT‐qPCR primers of let‐7g‐5p, LC3, Beclin1, Bax, Bcl‐2 and Caspase‐3 were designed using the Premier 5.0 software and then synthesized by Invitrogen Corp (Table 1 ). RNA was reversely transcribed into cDNA in accordance with the instructions of the PrimeScript RT kit (RR036A, Takara Biotechnology Co., Ltd.). The primers were amplified using a PCR instrument (7300, Applied Biosystems) in accordance with the instructions of the SYBR® Premix Ex TaqTM II kit (RR820A, Takara Biotechnology Co., Ltd.). Next, 2 μg of total RNA was used as the template, glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was regarded as the internal reference for HMGA2, β‐catenin, LC3, Beclin1, Bax, Bcl‐2, Caspase‐3 and protein kinase C (PKC) and U6 served as internal reference for let‐7g‐5p. The relative mRNA expression of these genes was determined using the 2‐ΔΔCt method.18
4
Molecular Mechanisms of Cellular Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reagents and antibodies included the following: Trizol (bioteke China); YBR Green PCR kit (Takara China); reverse transcription kit (Takara China); qPCR reaction system (Tsingke Biological Technology); BeyoECL Star (Beyotime Biotechnology); ani-caspase-3 antibody (Rabbit abcam); anti-Bcl-2 antibody (Rabbit abcam); anti-IL-1β antibody (Rabbit abcam); anti-Ampk gamma 3 antibody (Rabbit abcam); anti-IL-20 receptor alpha antibody (Rabbit abcam); anti-RAG2 antibody(Rabbit abcam); anti-NPTX2 antibody(Rabbit abcam); anti-Matriptase 2 antibody (Rabbit abcam); NFκBp65(Rabbit CST); β-Actin(i102) polyclonal antibody (Rabbit Bioworld); secondary antibody (Goat anti-Rabbit abcam); protein maker (Thermo).
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primers were designed and
synthesized by Tanzhen Biotechnology. The primer sequences for NFKB,
IL1B, TNF, TLR4, and ICAM1 are listed inTable 5 . The total RNA for H9c2 cells was extracted
by Trizol (BIOTEKE, Beijing, China) and was later employed to determine
the RNA concentration. According to the Prime-Script RT reagent kit
instruction, the RNA was then reversely transcribed into cDNA. Based
on the instruction of the kit, the polymerase chain reaction was initiated
at 85 °C for 1 min, followed by 40 cycles of amplification of
denaturation at 94 °C for 1 min and annealing at 60 °C for
20 s using a StepOne Plus device (Applied Biosystems). The 2-DDCT
method was adopted to analyze the data.
synthesized by Tanzhen Biotechnology. The primer sequences for NFKB,
IL1B, TNF, TLR4, and ICAM1 are listed in
by Trizol (BIOTEKE, Beijing, China) and was later employed to determine
the RNA concentration. According to the Prime-Script RT reagent kit
instruction, the RNA was then reversely transcribed into cDNA. Based
on the instruction of the kit, the polymerase chain reaction was initiated
at 85 °C for 1 min, followed by 40 cycles of amplification of
denaturation at 94 °C for 1 min and annealing at 60 °C for
20 s using a StepOne Plus device (Applied Biosystems). The 2-DDCT
method was adopted to analyze the data.
6
Real-time PCR Analysis of ACSL4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cells using TRIzol (BioTeke, RP1001, Beijing, China), and the resulting RNA samples were reverse transcribed using BeyoRT II M-MLV (BeyoTime, D7160L, Shanghai, China) reverse transcriptase to produce the corresponding cDNA. Real-time PCR analysis was performed on an Exicycler 96 instrument (Bioneer Corporation, Daejeon, Korea) using a SYBR Green PCR Kit (Solarbio, SY1020, Beijing, China). The relative expression of mRNAs was normalized to β-actin. The primer sequences are shown in Table 1 . Interference sequences and negative control sequences are shown in Table 2 .
List of Genetic Primers
| Name | Sequence (5’-3’) |
|---|---|
| mus ACSL4 F | AGAAGGATCTTGGGTTGA |
| mus ACSL4 R | GCTTGAAGGCATCTGTTA |
| mus β-actin F | CTGTGCCCATCTACGAGGGCTAT |
| mus β-actin R | TTTGATGTCACGCACGATTTCC |
| homo ACSL4 F | GCATTCCTCCAAGTAGACC |
| homo ACSL4 R | ATGAGCCAAAGGCAAGT |
| homo β-actin F | GGCACCCAGCACAATGAA |
| homo β-actin R | TAGAAGCATTTGCGGTGG |
Interference and Negative Control Sequence
| Name | Sequence (5’-3’) |
|---|---|
| siNC | UUCUCCGAACGUGUCACGUTT |
| ACGUGACACGUUCGGAGAATT | |
| siACSL4-1 | GUAUGUAUCUCUUGGGAAATT |
| UUUCCCAAGAGAUACAUACTT | |
| siACSL4-2 | CGGAAAUCAUGGAUAGAAUTT |
| AUUCUAUCCAUGAUUUCCGTT | |
| siACSL4-3 | GCAAAGAAGCAGUAGUUCATT |
| UGAACUACUGCUUCUUUGCTT |
7
Alzheimer's Disease Molecular Mechanisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pioglitazone, GW9662, and Aβ1–42 were purchased from Sigma, USA. Rabbit anti-rat polyclonal antibodies against IDE, BACE1, and APP were purchased from Abcam, UK. Rabbit anti-rat polyclonal antibodies against CDK5, PPARγ and Aβ1–42 were purchased from Wanleibio, Shenyang, China. Rabbit anti-rat polyclonal antibody against p-PPARγ-Ser273 was purchased from Bioss, Beijing, China. TUNEL assay kit, anti-β-actin antibody, and ECL reagent were purchased from Wanleibio, Shenyang, China. TRIzol, Super M-MLV reverse transcriptase, RNase inhibitor, and 2× Power Taq PCR MasterMix amplification reagent kit were purchased from BioTeke, Beijing, China. SYBR GREEN Master Mix was purchased from Solarbio, Beijing, China. Protein A sepharose beads were purchased from Santa Cruz, CA, USA.
8
Quantifying Gene Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was extracted from the cells using Genomic DNA Mini Preparation Kit with Spin Column (Beyotime Biotech.) and eluted in sterile distilled H2O. Total RNA was extracted using TRizol (Bioteke, Beijing, China), and converted to cDNA with Transcriptor First Strand cDNA Synthesis Kit (Roche). Total genomic DNA or cDNA was subjected to qPCR analysis with SYBR Green Master Mix (Thermo Fisher Scientific) in Applied Biosystems 7300. Results were considered positive when the fluorescent signal above the baseline was detected and the cycle number was recorded. The relative copy number of a gene was determined by calibration with the internal control (GAPDH for RNA, β-actin for DNA). Primers for the genes are listed as follows (gene: forward primer; reserve primer):
FXN: 5′-CCTTGCAGACAAGCCATACA-3′; 5′-CCACTGGATGGAGAAGATAG-3′; GAPDH: 5′-TGCACCACCAACTGCTTAGC-3′; 5′-GGCATGGACTGTGGTCATGAG-3′; CytB: 5′-TATCCGCCATCCCATACATT-3′; 5′-GGTGATTCCTAGGGGGTTGT-3′; β-actin: 5′-AGAAAATCTGGCACCACACC-3′; 5′-AACGGCAGAAGAGAGAACCA-3′
FXN: 5′-CCTTGCAGACAAGCCATACA-3′; 5′-CCACTGGATGGAGAAGATAG-3′; GAPDH: 5′-TGCACCACCAACTGCTTAGC-3′; 5′-GGCATGGACTGTGGTCATGAG-3′; CytB: 5′-TATCCGCCATCCCATACATT-3′; 5′-GGTGATTCCTAGGGGGTTGT-3′; β-actin: 5′-AGAAAATCTGGCACCACACC-3′; 5′-AACGGCAGAAGAGAGAACCA-3′
9
Ginsenoside Rg1 Modulates Alzheimer's Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ginsenoside Rg1 (molecular formula: C42H72O14; molecular weight: 801.01; HPLC purity: 98%) was purchased from Baoji Herbest Bio-Tech Co., Ltd. Aβ1-42 and roscovitine were purchased from Sigma Aldrich; Merck KGaA. Rabbit anti-rat IDE (cat. no. ab133561), BACE1 (cat. no. ab10716) and amyloid precursor protein (APP; cat. no. ab15272) polyclonal antibodies were purchased from Abcam. Rabbit anti-rat p-PPARγ-Ser273 polyclonal antibody (cat. no. bs-4888R) was purchased from BIOSS Antibodies. Rabbit anti-rat CDK5 (cat. no. WL01673), PPARγ (cat. no. WL0269) and Aβ1-42 (cat. no. WL01427) polyclonal antibodies, anti-β-actin antibody (cat. no. WL01845), goat anti-rabbit secondary horseradish peroxidase-conjugated antibody (cat. no. WLA023), TUNEL assay kit, total protein extraction kit, bicinchoninic acid (BCA) protein assay kit and enhanced chemiluminescence (ECL) reagent were purchased from Wanleibio Co., Ltd. Dulbecco's modified Eagle's medium (DMEM) was purchased from Gibco; Thermo Fisher Scientific, Inc. Fetal bovine serum (FBS) was purchased from Biological Industries. Trypsin and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Beyotime Institute of Biotechnology. TRIzol® and 2X Power Taq PCR MasterMix were purchased from BioTeke Corporation. SYBR Green master mix was purchased from Beijing Solarbio Science & Technology Co., Ltd.
10
Quantifying MAP4K3 Expression in Kidney
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from kidney tissues (renal cortex) and cells was extracted using TRIzol (RP1001; BioTeke, Beijing, China). RT was performed with the help of beyoRT II M-MLV reverse transcriptase (D7160L; Beyotime, Shanghai, China). RT-qPCR was performed in the Exicycler 96 Real-Time PCR Detection system (Korea) using SYBR Green (SY1020; Solarbio, Beijing, China) and PCR Master mix (PC1150; Solarbio). The primers used are listed as follows: MAP4K3 (mouse, 5'-3') AGTGCTGCGTGGTGAGAA (Forward), CGGAGTGGACACGGCATA (Reverse); MAP4K3 (rat, 5'-3') GCGTGGTGAGAAATCCTT (Forward), CCCTCTACTGACGCCAAC (Reverse). β-actin was used as an internal control. The relative quantitative expression was calculated according to the 2−ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!