Total RNA was extracted from 3D4/21 cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and the first-strand cDNA was synthesized using a First-Strand Synthesis System (Transgen, Beijing, China) according to the manufacturer’s instructions. The relative gene expression was analyzed by real-time RT-qPCR carried out on qTOWER3G Real-time PCR system (Analytik Jena AG, Jena, Germany). Relative gene expression levels were calculated using the comparative cycle threshold (CT) method according to the manufacturer’s protocol (Applied Biosystem, Foster City, CA, USA). All data presented are relatively quantitative, normalized to the β-actin and analyzed using GraphPad Prism 8.0 software. All primers used for real-time RT-qPCR are listed in Supplementary Table S2.
Qtower3g real time pcr system
Manufactured by Analytik Jena
Sourced in Germany, Japan
The QTOWER3G is a real-time PCR system manufactured by Analytik Jena. It is designed for performing quantitative real-time polymerase chain reaction (qPCR) analyses. The system is equipped with a thermal cycler and optical detection components to enable the amplification and quantification of nucleic acid samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
M mlv reverse transcriptase, by Promega (2 mentions)
Gotaq qpcr master mix, by Promega (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Kapa sybr fast qpcr master mix, by Roche (2 mentions)
Hiscript 2 q rt supermix for qpcr, by Vazyme (2 mentions)
Sybr green fast mixture, by GenStar (2 mentions)
Hiscript 2 q rt kit, by Vazyme (2 mentions)
Trizol reagent, by Merck Group (2 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (2 mentions)
Hiscript 3 rt supermix for qpcr, by Vazyme (2 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
First strand synthesis system, by Transgene (1 mentions)
Sybr green 1 master, by Roche (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Gdna eraser, by Takara Bio (1 mentions)
Tb green premix ex taq 2 reagent, by Takara Bio (1 mentions)
Plant rna kit, by Takara Bio (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Evo m mlv rt mix kit, by Accurate Biology (1 mentions)
25 protocols using qtower3g real time pcr system
1
Gene Expression Analysis by RT-qPCR
2
Quantitative Analysis of nAChR Subunits in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qRT-PCR) was performed using Analytikjena qTOWER3G Real-Time PCR system to amplify various nAChR subunits in each cell line, including α3, α4, α5, α7, α9, α10, β2, β3 and β4 nAChR subunits. Each qPCR reaction mix contained 5 µL of SYBR Green I Master (Roche, Indianapolis, USA), 2 µM of each primer, 1 µL cDNA and DNase and RNase-free H2O with total volume of 20 µL. The cycling conditions were 95 °C for 10 min (initial denaturation and polymerase activation) followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 58 °C for 40 s and extension at 60 °C for 60 s. To correct minor variations in mRNA extraction and reverse transcription, the gene expression values were normalized using the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Relative quantification of the mRNA level was computed by the comparative Ct (2−∆∆Ct) method [58 (link)]. The data were analyzed with a sequence detector software (Analytikjena qPCR software 3.2) and nAChR subunits expression levels in breast cancer cells were compared with those in human normal mammary gland epithelial cell line HS578BST. All tests were performed in triplicate.
3
Quantifying Plant Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the Plant RNA Kit (TaKaRa, Dalian, China) and following the manufacturer’s instructions, the total RNA was isolated from leaf samples. The qualified total RNA was digested with gDNA Eraser (TaKaRa, Dalian, China) to eliminate genomic DNA. The PrimeScriptTM RT reagent kit (TaKaRa, Dalian, China) was then used to create the first-strand complementary DNA (cDNA) from the treated total RNA. According to the manufacturer’s instructions, qRT-PCR was carried out with a qTOWER3G Real-Time PCR System (Analytik Jena AG, Jena, Germany) using TB Green® Premix Ex Taq™ II reagent (TaKaRa, Dalian, China). The experiment was replicated three times. The rice OsActin gene (LOC_Os03g50885) was used as the internal control. Based on the preceding techniques, the relative expression levels of the target genes were calculated [50 (link)]. The details of each gene-specific primer are presented in Table 1 and were taken from our previous study [38 (link)].
4
Quantifying Differential AS Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differential expression of AS events was validated using RT-qPCR. Total RNA was extracted using Trizol reagent (Invitrogen, USA). The cDNA was reverse transcribed using 2-6 μg of total RNA with the M-MLV reverse transcriptase (Promega, USA). RT-qPCR was performed on a qTOWER3 G real-time PCR system (Analytik Jena, Germany). The total reaction volume was 20 μL and consisted of 0.1 μM of each primer 10 μL of GoTaq® qPCR Master Mix (Promega, USA), and 20-100 ng of cDNA. The PCR reaction condition was as follows: 95 °C for 10 min, then 40 cycles of 95 °C for 15 s, and 60 °C for 1 min.
We chose a method similar to the PSI value calculation to quantify the expression of a specific AS event in GC and adjacent tissues. Two pairs of primers (Table S2 ) were used to amplify the AS isoforms and common transcripts. Data normalization with the reference GAPDH gene expression and the 2 -∆∆CT method was used to calculate the relative expression of each gene.
We chose a method similar to the PSI value calculation to quantify the expression of a specific AS event in GC and adjacent tissues. Two pairs of primers (
5
FUBP1 Expression in Chondrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The chondrocytes were divided into three groups: FUBP1-Con, FUBP1-KD and FUBP1-OE. The chondrocytes at a concentration of 2.0 × 105 cells/well were seeded in 6-well plates for 24 h. After 24 h, the medium was removed. Total RNA was extracted from chondrocytes using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and converted to cDNA using a kit named PrimeScript RT Master Mix (Takara Bio, Kusatsu, Shiga, Japan). qPCR was performed with SYBR Premix ExTaq (Takara Bio, Kusatsu, Shiga, Japan) in a qTOWER 3G Real-time PCR system (Analytik Jena, Jena, Germany). Primer sequences used were as follows: FUBP1 forward, 5′-GGAACAACACCTGATAGGATAGC-3′ and reverse, 5′-GCCAGCCTGAACACTTCGTAG-3′; GAPDH forward, 5′-AGGTCGGTGTGAACGGATTTG-3′ and reverse, 5′-TGTAGACCATGTAGTTGAGGTCA-3. The relative gene expression levels were quantified using the 2−ΔΔCT method and normalized to the internal reference gene GAPDH.
6
Quantifying Staphylococcus aureus Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The levels of expression for gyrb, hlα, crtM, seA, and seB were analyzed using reverse transcription (RT) followed by real-time quantitative PCR (qPCR). Briefly, a total of 2 mL of S. aureus grown with different concentrations of myricetin (0 to 32 μg/mL) was incubated at 37 °C with shaking at 200 rpm for 16 h. S. aureus grown without myricetin was treated in the same manner and used as a negative control. Subsequently, each sample was centrifuged at 10,000× g for 10 min to collect the bacteria. RNA was extracted from each culture using the SteadyPure RNA Extraction Kit (Accurate Biology, Changsha, Hunan, China), and its purity and concentration were determined using a SpectraMax ABS Puls (Molecular Devices, Shanghai, China). The RNA was then reverse-transcribed using the Evo M-MLV RT Mix Kit (Accurate Biology, Changsha, Hunan, China). The resulting cDNA was quantified using 2 × SYBR Green Abstart qPCR Mix from Sangon Biotech in a qTOWER3 G real-time PCR system (Analytic Jena, Jena, Germany). The primers used are listed in Table 2 . The RNA transcript levels were determined using the 2−ΔΔCT method. The experiment was conducted in triplicate for each reaction.
7
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Once the samples were isolated, they were stored in liquid nitrogen tanks unless we used them right away. Before adding Trizol, we take tissue samples from liquid nitrogen tanks and grind them with liquid nitrogen. Then, total RNAs were isolated from cartilage samples and chondrocytes using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and were reversed transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Kyoto, Japan). cDNA synthesis was performed with 1 μg of total RNA utilizing oligo dt-primer with a cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA). Real time PCR was performed using TB Green™ Premix Ex Taq™ (Tli RNaseH Plus) (Takara, Kyoto, Japan) on the qTOWER3G real time PCR system (analytikjena, Jena, Germany). Relative gene expression was calculated using ΔΔCt method and was normalized to U6 or GAPDH.25 (link)
The specific primer sequences (5’→3’) were as follows: miR-379-5p-F: GCGCTGGTAGACTATGGAA; miR-379-5p-R: GTGCAGGGTCCGAGGT, U6-F: CTCGCTTCGGCAGCACATATACT; U6-R: ACGCTTCACGAATTTGCGTGTCYBX1, YBX1-F: GGGTGCAGGAGAACAAGGTA; YBX1-R: TCTTCATTGCCGTCCTCTCT, PI3K-F: AGCATGGTCAGCTTTCTTCTT; PI3K-R: GAATGGAAGACGGGAGATTCA, AKT-F: CCAGGATCCATGGGTAGGA; AKT-R: GCAGCCCCTTTGACTTCTT, GAPDH-F: CCATGTTCGTCATGGGTGTGAACCA; GAPDH-R: GCCAGTAGAGGCAGGGATGATGTTCPI3K.
The specific primer sequences (5’→3’) were as follows: miR-379-5p-F: GCGCTGGTAGACTATGGAA; miR-379-5p-R: GTGCAGGGTCCGAGGT, U6-F: CTCGCTTCGGCAGCACATATACT; U6-R: ACGCTTCACGAATTTGCGTGTCYBX1, YBX1-F: GGGTGCAGGAGAACAAGGTA; YBX1-R: TCTTCATTGCCGTCCTCTCT, PI3K-F: AGCATGGTCAGCTTTCTTCTT; PI3K-R: GAATGGAAGACGGGAGATTCA, AKT-F: CCAGGATCCATGGGTAGGA; AKT-R: GCAGCCCCTTTGACTTCTT, GAPDH-F: CCATGTTCGTCATGGGTGTGAACCA; GAPDH-R: GCCAGTAGAGGCAGGGATGATGTTCPI3K.
8
Validating Differential Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the DEG results, quantitative reverse transcription PCR (qRT-PCR) was conducted on 15 DEGs with ubiquitin (OsUBI) as the internal reference. The primer sets used for qRT-PCR were designed according to the individual gene sequences (Supplementary Table 1 ). The cDNA was generated by reverse transcription using the First-Strand cDNA Synthesis Kit (TransScript, Beijing, China), following the manufacturer’s protocol. The qRT-PCR experiments were conducted using a qTower3G Real-Time PCR System (Analytik Jena AG, Germany) according to the manufacturer’s protocol. PCR was performed in 20 μl of reaction volume, containing 2 μl of cDNA, 0.4 μl of each specific primer, 10 μl SYBR Premix Ex Taq™ (Takara, Dalian, China), and 0.4 μl ROX reference dye. Each reaction was performed three times. The relative gene expression levels were calculated using the 2–ΔΔCT method (Livak and Schmittgen, 2001 (link)).
9
RNA Isolation, cDNA Synthesis, and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells or endogenous sympathetic ganglia using the NucleoZOL RNA isolation reagent (MACHEREY-NAGEL, #740404.200) according to the manufacturer’s instruction. cDNA was synthesized using the HiScript II QRT SuperMix for qPCR (Vazyme Biotech). qRT-PCR was performed using the Kapa SYBR fast qPCR master mix (Kapa) and qTOWER3G Real-Time PCR system (Analytikjena). The data were analyzed using the 2-ΔΔct calculation method. The qRT-PCR primers used are shown in Table S3 .
EdU labeling was performed as previously described.32 (link) MEFs were labeled by 10 μM EdU for 12 days starting from day 1 following infection with APH lentiviruses, or for 48 hrs starting from day 14. EdU staining was carried out according to the manufacturer’s instruction (Life Technologies).
EdU labeling was performed as previously described.32 (link) MEFs were labeled by 10 μM EdU for 12 days starting from day 1 following infection with APH lentiviruses, or for 48 hrs starting from day 14. EdU staining was carried out according to the manufacturer’s instruction (Life Technologies).
10
Validating Transcriptome Data through qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to verify the validity of the transcriptome data, 5 DEGs were selected for qRT-PCR with the PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Bio, Japan); the reaction was performed on the qTower3G Real-Time PCR System (Analytik Jena AG, Jena, Germany). The PCR amplification was initially heated to 95 °C, which lasted for 10 min, followed by, 40 cycles of 94 °C for 10 s, 60 °C for 20 s, and 60 °C for 20 s. The 16s was used as the internal reference gene to normalize gene expression, and the 2-ΔΔCt method was used for relative quantification. The list of primers is given in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!