Cdna synthesis kit

Total RNA was isolated by Trizol, and then was reverse transcribed using cDNA synthesis kit (DBI Bioscience, Ludwigshafen, Germany). All primers were designed by Premier 5.0 software or reported in previous literature [7 (link)], and were synthesized by Invitrogen. The primer sequences are as followings: rat TNF-α (sense: TGTTCATCCGTTCTCTACC; antisense: CCACTACTTCAGCGTCTC), rat IL-6 (sense: CGGAGAGGAGACTTCACA; antisense: GCATCATCGCTGTTCATAC), rat collagen type I (Col1a1) (sense: ATCCTGCCGATGTCGCTAT; antisense: CCACAAGCGTGCTGTAGGT), rat collagen type III (Col3a1) (sense: CTGGTCCTGTTGGTCCATCT; antisense: ACCTTTGTCACCTCGTGGAC), rat angiotensin-converting enzyme (ACE) (sense: TTGGCTCTGTCTGTGTCT; antisense: CTCCTTGGTGATGCTTCC), rat Ang (sense: CTGGAGCTAAAGGACACACAGA; antisense: CAGGGTCTTCTCATCCACGG), rat Renin (sense: CACCTTCATCCGCAAGTT; antisense: GCAGAGCCAGACAGAATG), rat AT1R (sense: GGCAGGCACAGTTACATAT; antisense: CAAGGCGAGATTGAGAAGA). Each real-time PCR were carried out in a total volume of 20 μl with SYBR Green PCR Master Mix (DBI Bioscience) with the reaction condition: 95°C 2min, 40 cycles at 95°C 15S, 60°C 15S, 68°C 10S, 72°C 20S. Relative mRNA expression levels were firstly normalized to β-actin by using the ΔΔCt method and then normalized the value for each sample by divided it by the value of one sample from that of the Con+Ve group.

Total RNA of the adipose tissue was extracted with TRIzol according to the manufacturer’s instructions. One microgram of total RNA was reverse-transcribed using a cDNA synthesis kit (DBI Bioscience). The expression of mRNA for the indicated genes was quantified by quantitative RT-PCR with the SYBR Premix ExTaq kit (DBI Bioscience) and normalized to the expression of β-actin. The relative mRNA expression levels were calculated and compared by the 2^–ΔΔCt method. Primers used for each gene are listed in Supplementary Table S1.

Rats were anesthetized with pentobarbital (2%, 40 mg/kg) and killed, and the DRGs were quickly removed and stored in liquid nitrogen as previously described [31 (link)]. Total RNA was isolated using RNA-Easy Isolation Reagent (Vazyme Biotech, China), and complementary DNA (cDNA) was generated using a cDNA Synthesis Kit (DBI Bioscience, Germany) according to the manufacturer’s instructions. RT–qPCR was carried out using SYBR Green (DBI Bioscience, Germany) and the StepOnePlus™ Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, USA). Relative gene expression levels were calculated by the comparative cycle threshold (CT; 2^−ΔΔCt) method. GAPDH was used as a housekeeping gene. The sequences of primers specific for STING and GAPDH were as follows:
STING: sense: 5′-CAGCCTGATGAGCCTTTGGATGAC-3′;
Antisense: 5′-GGACTGGACATGGCACAACTCTTC-3′;
GAPDH: sense: 5′-GGTGGACCTCATGGCCTACA-3′;
Antisense: 5′-CTCTCTTGCTCTCAGTATCCTTGCT-3′.