Trizol solution

Total RNA was isolated using Trizol solution (Sigma-Aldrich, Saint-Louis, MO, USA) and reverse transcription of 2 μg RNA for each sample was performed with the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s recommendations. qPCR was carried out using Maxima Syber Green PCR Master mix (Thermo Fisher Scientific, Waltham, MA, USA) and ran for 10 min at 95 °C for initial denaturation followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Sample Ct values were normalized to actin. Relative expression was calculated using the ΔΔCt method. All amplifications were performed in triplicate. Results were calculated from three independent experiments. Oligonucleotide sequences (5′-3′) used for qPCR are as follows: Actin_S: ccaaccgcgagaagatgacc, Actin_A: gatcttcatgaggtagtcagt, Pcmt1_S: gcttgttgtgggggatggaa, Pcmt1_A1: cccccatcagaggcttcattt, Pcmt1_A2: aatcacttccacctggaccac Pcmt1_A3: cttttacaattcatccctggaccac.

Plasmacytoid dendritic cells (pDCs) were isolated from leukocyte suspensions enriched from human blood in leukocyte reduction chambers as described [13] (link) or from erylysed mouse whole blood by MACS using the according isolation kits (Miltenyi Biotec). 3×10⁵ isolated pDCs or 2,5×10⁶ whole blood cells were then incubated in complete DMEM medium for 24 h at 37°C with 0,5 µM Type A CpG 2216 (InvivoGen), 1 µg/ml R848 (Resiquimod, InvivoGen), 10 µg/ml genomic DNA (Novagen), 1 µg/ml total RNA isolated from human cell cultures or murine splenocytes using Trizol solution (Sigma-Aldrich), 50 µg/ml CRAMP/LL37 (both from Innovagen), or CRAMP/LL-37 complexed to DNA or RNA, respectively, as described [1] (link), [4] (link). Type I IFN in supernatants was measured by a luciferase assay using HEK293 IFN reporter cells as described [14] (link) or by multiplex bead technology (eBioscience).

Spheroid‐containing gels were lysed in TRIzol solution (Sigma), and RNA was isolated by isopropanol precipitation. RNA was sequenced at the genomics core facility at Queen Mary University of London (QMUL). Library preparation was performed using an NEB Next Ultra II (E7645S, NEB, Hitchin, UK) kit, and run on an Illumina NextSeq 500 (150 cycles, Illumina, Cambridge, UK). Reads were aligned to a combined human and mouse genome (using Human Hg38 and mouse mm10) using the STAR aligner, then separated based on species. Ambiguous reads were discarded from further analysis. Differential analysis between cell types from the same species was performed using Partek Flow software (Version 10, Partek, Chesterfield, MO, USA). Genes with greater than 2‐fold difference, with a false discovery rate (FDR) <0.01, were considered significantly different between groups. Gene overrepresentation analysis was performed using WEB‐based gene set analysis toolkit platform (http://www.webgestalt.org/, accessed March 2020).

Mtb PLB formed within biofilm culture or following treatment with 100 µg mL^–1 d-cycloserine was harvested at various time points (days 16, 22, and 28 for biofilm culture and days 1, 7, and 14 for d-cycloserine treatment). The total RNA was extracted using TRIzol solution (Sigma-Aldrich) and mechanical lysing with 0.1-mm zirconia beads in a Precellys tissue homogenizer. Lysates were clarified by centrifugation and TRIzol supernatant was removed and used for RNA extraction. RNA was isolated using a Qiagen RNA extraction kit. Isolated RNA was treated with DNase I to remove DNA contamination (Sigma-Aldrich). RNA concentrations were determined using a Nanodrop, and qRT-PCR reactions were conducted using an iQ SYBR-Green Supermix (Bio-Rad) and C1000TM Thermal Cycler Instrument. Primers used for amplification are listed in Supplementary Table 1. Fold changes were calculated by ΔΔC_T values that were normalized to sigA transcript levels and depicted as log₂ values relative to planktonic growth with no antibiotic treatment.

Total RNA from EWAT and quadriceps femoris muscle was isolated by Trizol solution (Sigma-Aldrich, St. Louis, MO, USA) and translated to cDNA using the FirstStrand cDNA synthesis kit (Amersham Pharmacia, Philadelphia, PA, USA). The mRNA expression levels were evaluated using gene-specific primers and probe, and TaqMan Gene Expression and Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA), respectively, in ABI PRISM 7700 systems. PCR reactions were performed according to the following protocol: samples were heated to 94 °C for 2 min, followed by 40 cycles of 94 °C for 20 s, 60 °C for 20 s, and 72 °C for 30 s. The expression levels of the genes of interest in each treated group were determined after normalizing levels to Gapdh expression as an internal control by using comparative cycle threshold (Ct) analysis. The used primer and probe sequences are shown in Supplementary Table S1.

Total RNA was extracted from testicular fragments using TRIzol solution as described by manufacturer (Sigma-Aldrich, St Louis, MO, USA). Qualitative evaluation of the extracted RNA was performed using a NanoDrop instrument[38 (link)]. cDNA synthesis was carried out by SCRIPT cDNA synthesis kit (prime synthesis kit, TAKARA, Japan). All the steps were performed in a thermal cycler (Eppendorf, Germany), and the final product was kept at -20 °C.