Neb hi fi dna assembly kit

Plasmids for transgenesis were assembled using the NEB HIFI DNA Assembly Kit (New England Biolabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions into the pUC19 vector linearised with SmaI (ThermoFisher, Waltham, MA, USA). Plasmid constructs were Cel-col-19p::Pun-pgp-9::FLAG::Cel-unc-54_3′-UTR utilising the col-19 promotor [39 (link)] to drive epidermal Pun-PGP-9 expression (Supplementary Figure S3a) and Cel-ges-1p::Pun-pgp-9::FLAG::Cel-unc-54_3′-UTR (Supplementary Figure S3b) utilising the ges-1 promotor [38 (link)] to drive intestine-specific Pun-PGP-9 expression. The C. elegans unc-54 3′-UTR [41 (link)] and the Pun-pgp-9 cDNA [23 (link)] were amplified from verified plasmids, while the 3′ end primer for the Pun-pgp-9 amplification introduced an in-frame FLAG-tag (DYKDDDDK) before the stop codon (all primers in Supplementary Table S3). The C. elegans promotors col-19p and ges-1p [38 (link)] were amplified from genomic DNA extracted from the Bristol N2 strain [39 (link)]. A co-injection marker plasmid (pPD118.33) driving pharyngeal GFP expression was used (Addgene L3790 plasmid #1596 was a gift from A. Fire). Sequences of all constructs were confirmed by Sanger-sequencing (LGC Genomics, Hoddesdon, UK).

The Cdk8-superfolder-GFP line (referred to as Cdk8::GFP) was generated as described^{43 (link)}. Briefly, a fragment with gRNAs targeting 5′UTR (GTTATCGGGAGACAGCTGATTGG) and end of coding region (TTAGAAGGCTAGAAATTAGTAGG) of cdk8 and 200 bps of homology arms (corresponding to 200 bps upstream of 5’ sgRNA cut site and 200 bps downstream 3’ sgRNA cut site) were synthesized and cloned in pUC57_Kan_gw_OK2 custom vector backbone, generating a homology donor intermediate vector by Genewiz/Azenta. Fragments for the gene coding region (between 5’ sgRNA PAM sequence up to final amino acid before the stop codon), linker-sfGFP-stop codon and Scarless-DsRed were PCR amplified with primers containing overlaps and the fragments were assembled using NEB-HiFi DNA Assembly kit (New England Biolabs #E2621) using manufacturer’s instructions, in the homology donor intermediate linearized by BsaI-HF (NEB #R3535) to generate the homology donor vector for injection. Homology donor vector (250 ng/μL) was injected into y¹w^*; attP40(y + ){nos-Cas9(v + )}; iso5 embryos^{81 (link)}. The resulting G0 males and females were crossed to y w flies to screen for the presence of 3XP3-DsRed. The resulting transgenics were PCR-verified with primers that amplify tagged gene-specific amplicons.

Cloning of Wu01- and BA.4/5 spike protein expression plasmids was previously described^{13 (link),40 (link)}. Compared with the Wu01 strain spike protein amino acid sequence, for the Omicron BA.4/5 strain, the following changes were included in the plasmid: T19I, Δ24-26, A27S, D69-70 G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R S477N, T478K, E484A, F486V Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K mutations. For the BQ.1.1 spike protein expression plasmid, a gene fragment (Thermo Fisher) encompassing the additional R346T, K444T, and N460K mutations were cloned into the BA.4/5 spike protein expression plasmid using the NEB HiFi DNA Assembly Kit (New England Biolabs). All spike protein expression plasmids incorporate a C-terminal deletion of 21 cytoplasmic amino acids that results in increased pseudovirus titers. Sanger sequencing was used for verification of the spike sequence.