β actin

BMMC were cultured with or without 10ng/ml of TGFβ1 for 3 days prior to IL-33 stimulation for 2 hours. Cells were harvested and total RNA was extracted with TRIzol reagent (Life Technologies, Grand Island, NY). RNA was quantified using the Thermo Scientific NanoDrop™ 1000 UV–vis Spectrophotometer (Thermo Scientific, Waltham, MA) according to the manufacturer’s recommended protocol. cDNA was synthesized using the qScript™ cDNA Synthesis from Quanta Biosciences (Gaithersburg, MD). BioRad CFX96 Touch™ Real-Time PCR Detection System (Hercules, CA) was used to amplify message using PerfeCTa SYBR Green SuperMix (Quantabio, Gaithersburg, MD). Primers for IL-6 (forward: 5′TCCAGTTGCCTTCTTGGGAC3′, reverse: TCCAGTTGCCTTCTTGGGAC3′), IL-13 (forward: 5′ ATGGCGCTCTGGGTGACTGCAGTCC, reverse: 5′GAAGGGGCCGTGGCGAAACAGTTGC), TNF (forward: 5′AGCACAGAAAGCATCATCCGC3′, Reverse: 5′TGCCACAAGCAGGAATGAGAAG3′), β-actin (forward: 5′GATGACGATATCGCTGCGC3′, Reverse: 5′CTCGTCACCCACATAGGAGTC3′), were purchased from Eurofins MWG Operon (Huntsville, AL). Amplification conditions consisted of a heat-activation step at 95°C for 2 minutes followed by 40 cycles of 95°C for 15 seconds, 55°C for 30 seconds and 60°C for 1 minute. All melting curve analysis was performed between 50°C and 95°C. Results were normalized to housekeeping genes using Livak Method.