Mmp 9

Manufactured by BioLegend

Sourced in United Kingdom, United States

MMP-9 is a recombinant human matrix metalloproteinase-9 protein. Matrix metalloproteinases (MMPs) are a group of enzymes involved in the breakdown and remodeling of the extracellular matrix. MMP-9 specifically degrades type IV collagen, a major component of the basement membrane.

Automatically generated - may contain errors

Lab products found in correlation

Pierce bca protein assay kit, by Thermo Fisher Scientific (2 mentions) Human active mmp 9 fluorokine e kit, by R&D Systems (1 mentions) Mmp 9, by Thermo Fisher Scientific (1 mentions) Phosphate buffered saline (pbs), by Thermo Fisher Scientific (1 mentions) Q sybr green supermix, by Bio-Rad (1 mentions) Cxcl1, by Abcam (1 mentions) Iscript cdna synthesis kit, by Bio-Rad (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Il 1β, by BioLegend (1 mentions) Caspase 3, by Thermo Fisher Scientific (1 mentions) Mmp 1, by Thermo Fisher Scientific (1 mentions) Dq type 1 collagen, by Thermo Fisher Scientific (1 mentions) β actin, by Media Cybernetics (1 mentions) Image pro plus 4, by Media Cybernetics (1 mentions) Immobilon western chemiluminescent hrp substrate, by Merck Group (1 mentions) Polyvinylidene difluoride membrane, by Merck Group (1 mentions) β actin, by BD (1 mentions) Bz 9000, by Keyence (1 mentions) Interleukin 6 (il 6), by BioLegend (1 mentions) Ifn γ, by BioLegend (1 mentions)

Close spelling variants of this product

Legend Max Human MMP-9 Recombinant human MMP-9 Recombinant MMP-2 and MMP-9 LEGEND MAX™ Human MMP-9 ELISA Kit

8 protocols using mmp 9

In Vitro Assessment of MMP-9 Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols

To measure the in vitro activity of released MMP-9 (Biolegend), 1 μg of MMP-9 was encapsulated in 30 μL of hydrogel, allowed to gel at the bottom of microcentrifuge tubes, and incubated in 1 mL of PBS (Gibco) (n=3). 100 μL of the supernatant was collected on day 6 and replenished with equal volume of fresh PBS. A 100-fold dilution of collected samples was used to measure MMP-9 activity using the Fluorokine® E Human Active MMP-9 kit (R&D Systems) according to manufacturer’s protocol.
For proteolytic activity of released MMP-9, MMP-9 supernatants collected from hydrogel with MMP-9 or VEGF-A+MMP-9 at day 3 release were separated on a zymography gel (Thermo Fisher). Two MMP-9 standards with concentrations of 50 and 100 ng/μL were also included. Proteolytic activity of the released MMP-9 was qualitatively evaluated as light bands on the otherwise dark zymography gel, as reported previously [29 (link)].

George P.M., Oh B., Dewi R., Hua T., Cai L., Levinson A., Liang X., Krajina B.A., Bliss T.M., Heilshorn S.C, & Steinberg G.K. (2018). Engineered Stem Cell Mimics to Enhance Stroke Recovery. Biomaterials, 178, 63-72.

+ Open protocol

+ Expand

Inflammatory Cytokine and Protease Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The levels of serum matrix metalloproteinase-9 (MMP-9) (Biolegend, San Diego, CA), IL-1β (Biolegend), TNF-α and IL-17 (Life Technologies, Carlsbad, CA), and CXCL-1 (Abcam, Cambridge, UK) were measured by ELISA using commercially available kits according to the instruction of the manufacturers. Expression of MMP-9, IL-1β, TNF-α, and IL-17 was also measured by quantitative real-time PCR. To that end, total RNA was isolated from rat synovial tissue and extracted using TRIzol Reagent (Life Technologies, Carlsbad, CA). For cDNA synthesis, we used iScript cDNA Synthesis Kits (BioRad, Hercules, CA). Real-time PCR was performed using Q SYBR Green Supermix (BioRad). The following primers were used: (1) MMP-9 (forward: GGATGGTTATCGCTGGTG; reverse: AGTAGGACAGAAGCCATACA), (2) IL-1β (forward: TTCGACAGTGAGGAGAATGACC; reverse: CAAGACATAGGTAGCTGCCACA), (3) TNF-α (forward: CCTCACACTCAGATCATCTTCTCA; reverse: CTCCTCCGCTTGGTGGTT), (4) CXCL-1 (forward: ACCGAAGTCATAGCCACACTC;, reverse: CGCCATCGGTGCAATCTATCT), and (5) IL-17 (forward: CATCCATGTGCCTGATGCTGTTG; reverse: GGAACGGTTGAGGTAGTCTGAGG). The data were normalized to the expression levels of β-actin (forward primer: CAACGGCTCCGGCATGTGC, reverse primer: CTCTTGCTCTGGGCCTCG). The PCR conditions were 40 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s.

Peng H.Y., Chen S.Y., Siao S.H., Chang J.T., Xue T.Y., Lee Y.H., Jan M.S., Tsay G.J, & Zouali M. (2020). Targeting a cysteine protease from a pathobiont alleviates experimental arthritis. Arthritis Research & Therapy, 22, 114.

+ Open protocol

+ Expand

Serum Protein Profiling in COVID-19

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunoassays were performed to quantify the protein levels of selected characteristic molecular candidates in patient sera. The selection of analytes was based on transcriptome profiling results and previous studies [17 (link),18 (link),19 (link)]. Custom-made multiplex immunoassays (ProcartaPlex, Thermo Fisher Scientific, Waltham, MA, USA) were used to investigate the following analytes: Caspase-3, CD40, IL-8, MMP1, PAI-1, and VEGFA. Serum levels of ITGB3 (Abbexa, Cambridge, UK), LGALS2 (Abbexa, Cambridge, UK), and MMP9 (BioLegend, San Diego, CA, USA) were measured using singleplex immunoassays according to the manufacturer’s protocol. All data were analyzed following the manufacturer’s instructions. Additionally, an independent patient cohort consisting of COVID-19 patients with or without aspergillosis was investigated by the following immunoassays according to the manufacturer’s instructions: IL-8 (BioLegend, San Diego, CA, US), Caspase-3 (ThermoFisher, Waltham, MA, USA), and MMP1 (ThermoFisher, Waltham, MA, USA).

Zoran T., Seelbinder B., White P.L., Price J.S., Kraus S., Kurzai O., Linde J., Häder A., Loeffler C., Grigoleit G.U., Einsele H., Panagiotou G., Loeffler J, & Schäuble S. (2022). Molecular Profiling Reveals Characteristic and Decisive Signatures in Patients after Allogeneic Stem Cell Transplantation Suffering from Invasive Pulmonary Aspergillosis. Journal of Fungi, 8(2), 171.

+ Open protocol

+ Expand

DQ Collagen Degradation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

DQ collagen type I (ThermoFisher, Waltham, MA) assays were performed as directed by the user manual. Briefly, DQ collagen was diluted to a final concentration of 12.5 μg ml⁻¹ in DQ collagen buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM CaCl₂, pH 7.6). MMP-9 (BioLegend, San Diego, CA) was diluted to a concentration of 1 μg ml⁻¹ in DQ collagen buffer and added at a final concentration of 0.05 μg ml⁻¹. Aureolysin (Preparatis, Krakow, Poland) was diluted to a concentration of 1 μg ml⁻¹ and added at a final concentration of 0.05 μg ml⁻¹. When culture supernatant was added, cultures were grown overnight for approximately 16 h. Cells were spun down, and the supernatant was filtered through a 0.22-μm filter, with 15 μl of supernatant added to the 200-μl reaction mix. Plates were immediately read on a TECAN InfinitePro (Männedorf, Switzerland) at 480 nm/520 nm every 30 s.

Lehman M.K., Nuxoll A.S., Yamada K.J., Kielian T., Carson S.D, & Fey P.D. (2019). Protease-Mediated Growth of Staphylococcus aureus on Host Proteins Is opp3 Dependent. mBio, 10(2), e02553-18.

+ Open protocol

+ Expand

Quantitative Immunoblot Analysis of EAE Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Spinal cord and brain tissues harvested from C57BL/6 EAE mice were lysed in radioimmunoprecipitation assay (RIPA) buffer containing 50 mM Tris-HCl (pH8.0), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 1 mM PMSF, and 1× protease inhibitor cocktail with 0.3% SDS. Following tissue homogenization, the concentrations of tissue proteins were measured by using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific). The lysate samples were then subjected to electrophoresis and transferred onto the polyvinylidene difluoride membranes (MilliporeSigma). The membranes were then incubated with primary antibodies of MMP9 (1:1000, clone: L51/82, BioLegend), MMP3 (1:1000, clone: M4405F10, BioLegend), Nrf2 (1:100, Cat# 16396-I-AP, Proteintech), HO-1 (1:2000, Cat# 10701-I-AP, Proteintech), or β-actin (BD Biosciences) overnight followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (BD Biosciences) for 1 hour. Immunoreactivities were then visualized by Immobilon™ Western Chemiluminescent HRP Substrate (MilliporeSigma). The intensity of designated protein bands was densitometrically quantified and then normalized with β-actin by using the Image Pro-Plus 4.5 (Media Cybernetics, Rockville, MD, USA).

Weng W.T., Kuo P.C., Brown D.A., Scofield B.A., Furnas D., Paraiso H.C., Wang P.Y., Yu I.C, & Yen J.H. (2021). 4-Ethylguaiacol modulates neuroinflammation and Th1/Th17 differentiation to ameliorate disease severity in experimental autoimmune encephalomyelitis. Journal of Neuroinflammation, 18, 110.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Gastric Carcinoma

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tumors tissues were isolated from gastric carcinoma xenograft mice and were fixed using 10% formaldehyde for 2 h at 37°C and embedded in paraffin. Tumor samples were cut into sections (4-µm-thick) and antigen retrieval was performed as described previously (33 (link)). Tumor sections were blocked in 5% BSA for 1 h at 37°C and incubated with the following primary antibodies: Rabbit anti-mouse ki67 (1:1,000; cat. no. 652401), HIF (1:500; cat. both no. 580809; Biolegend, Inc., San Diego, CA, USA), TWIST1 (1:500; cat. no. 573208; Biolegend, Inc.), MMP9 (1:500; cat. no. PAB19095), SOX4 (1:500; cat. no. PAB14092; both Abnova Corporation), N-cadherin (1:200; cat. no. NBP238856), CT-I (1:200; cat. no. NB6004080.01MG; both Novus Biologicals) and FIB (1:500; cat. no. P1H11; R&D Systems, Inc.) for 12 h at 4°C. Subsequently, tumor sections were incubated with HRP-conjugated anti-IgG (1:10,000; cat. no. ab6721, Abcam) for 24 h at 4°C. The results were visualized using a LumiGLO chemiluminescence system (Cell Signaling Technology, Inc., Danvers, MA, USA). Images were obtained using a fluorescent microscope (BZ-9000; Keyence Corporation, Osaka, Japan) at magnification, ×40.

Yuan C.L., Liang R., Liu Z.H., Li Y.Q., Luo X.L., Ye J.Z, & Lin Y. (2018). Bone morphogenetic protein and activin membrane-bound inhibitor overexpression inhibits gastric tumor cell invasion via the transforming growth factor-β/epithelial-mesenchymal transition signaling pathway. Experimental and Therapeutic Medicine, 15(6), 5422-5430.

+ Open protocol

+ Expand

Quantifying Cytokine Levels in Cultures and Plasma

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cytokine concentration in supernatants from cultures and plasma from patients was assessed by ELISA assays according to the manufacturer’s specifications. R&D Systems was used for IL-6 (DY406), IL-8 (DY208), IL-10 (DY217B), and MMP-9 (DY211), and Biolegend was used for IFN-α (446404) and IFN-γ (430104).

de Souza Andrade M.M., Leal V.N., Fernandes I.G., Gozzi-Silva S.C., Beserra D.R., Oliveira E.A., Teixeira F.M., Yendo T.M., Sousa M.D., Teodoro W.R., Oliveira L.D., Alberca R.W., Aoki V., Duarte A.J, & Sato M.N. (2022). Resveratrol Downmodulates Neutrophil Extracellular Trap (NET) Generation by Neutrophils in Patients with Severe COVID-19. Antioxidants, 11(9), 1690.

+ Open protocol

+ Expand

Characterizing Stem Cell Surface Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

hWJSCs and hBMMSCs were cultured in a Lab-Tek® Chambered #1.0 Borosilicate coverglass system (Thermo Scientific) until confluence. The cells were then fixed in 4% paraformaldehyde for 10 min, permeabilized with 0.1% Triton-X100 for 10 min, and then washed with PBS. Non-specific blocking was carried out with 10% normal goat serum for 10 min. The cells were incubated with primary antibodies CD29, CD44, CD146, VCAM-1, MMP-2, MMP-9, SDF-1a, ICAM-1, fibronectin, laminin, hyaluronic acid, and collagen type IV (Biolegend, San Diego, USA) at 4 °C overnight. The cells were then incubated with appropriate secondary antibodies (Invitrogen Life Technologies) for 30 min at room temperature in the presence of 1 mg/mL Hoechst 33342 and mounted on to slides with appropriate mounting medium. Photographs were taken using an Olympus FluoView FV1000 laser scanning confocal microscope (Olympus, Japan).

Lin H.D., Fong C.Y., Biswas A, & Bongso A. (2020). Allogeneic human umbilical cord Wharton’s jelly stem cells increase several-fold the expansion of human cord blood CD34+ cells both in vitro and in vivo. Stem Cell Research & Therapy, 11, 527.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!