Phusion hot start flex dna polymerase

SH-SY5Y cells (ATCC) were cultured and transfected 24 h later using the calcium-phosphate precipitation protocol^{22 (link)}. The cells were co-transfected with the mitochondrial calcium reporter Cepia2-MT (Addgene plasmid # 58218), a pLKO.1 plasmid harboring validated shRNA targeted against the 3ʹUTR region of endogenous SLC8B1-NCLX (Sigma Aldrich, Mission shRNA TRC number 5045), and a plasmid to express human WT NCLX (Addgene #75216) or the NCLX^P367S variant. Note that WT and P367S NCLX inserts are insensitive to the shRNA construct because they lack the 3ʹUTR of endogenous NCLX. The NCLX^P367S variant was generated by site-directed mutagenesis using Phusion® Hot Start Flex DNA Polymerase (New England Biolabs) using the forward primer 5ʹ CATCTGGTTATCAGCTCCCTGGTTGTGGTC 3ʹ and reverse primer 5ʹ GACCACAACCAGGGAGCTGATAACCAGATG 3ʹ. The cells were first bathed in Ringer solution^{44 (link)}, which was replaced with calcium-free Ringer’s solution supplemented with 100 µM ATP^{23 (link)}. The resultant mitochondrial calcium signals were imaged (480 nm/535 nm excitation/emission). Measured values were normalized by the average baseline throughout (ΔF/F₀) and were averaged across multiple cells in the field of view. The rate of calcium efflux was calculated by linearly fitting the change in the fluorescence after the peak for 150 s^{23 (link)}.

One microgram of RNA was used for cDNA production using the qScript Flex cDNA synthesis kit (95049, Quanta) and a gene-specific primer containing library 3′ adapter and part of the Illumina RD2 region. The entire cDNA reaction was diluted into 100 mL second strand reaction with a primer containing a unique molecular identifier (UMI), library 5′ adapter and part of the Illumina RD1 region. The second strand reaction was carried for a single cycle using Phusion Hot Start Flex DNA Polymerase (NEB, M0535), purified using AMpure beads at a 1.2:1 beads:sample ratio and eluted in ddH₂O. Product was used for amplification with barcoded primers, and the amplified libraries were purified by two-sided AMpure purification; First with a 0.5:1 beads:sample ratio followed by a 0.7:1 ratio. Libraries were sequenced a NextSeq 500 or NovaSeq 6000 machine to obtain 150 nt single-end reads.

The oligonucleotide pool targeting 53 candidate genes from profiled heterogeneity and controls (ten individual sgRNAs per gene) was customized at CustomArray, Inc. Then, the oligo pool was annealed and subcloned into lentiCRISPRv2 (Addgene, 52961) backbone using the Gibson Assembly Kit (NEB) and electroporation according to the protocol from Zhang’s lab^{72 (link)}. Library representation was maintained for at least 1000× coverage at each step of the process. To qualify the sgRNA representation, the constructed library was amplified by two-step PCRs using Phusion® Hot Start Flex DNA Polymerase (NEB, M0535L), in which the second step of PCR was conducted using the PCR amplicon from the first PCR as template. The primers for the first step of PCR are 5′-AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG-3′ (Forward) and 5′-TAGGCACCGGATCAATTGCCGAC-3′ (Reverse). The primers for the step of PCR are 5′-(1–9 bp of variable length sequence)TCTTGTGGAAAGGACGAAACACCG-3′ (Forward) and 5′-(1–9 bp of variable length sequence)TGTGGGCGATGTGCGCTCT-3′ (Reverse). The amplicon was sent for next-generation sequencing (NGS) at Mingma Technologies using illumina Hiseq X10 (3.3 M reads, 1 G data) to qualify sgRNA library distribution before screening^{72 (link)}.

Primers used in this work are provided in Table 3 and were synthesized by Integrated DNA Technologies (Coralville, IA). PCR products of gene deletions and plasmid modifications were validated using Sanger sequencing at Functional Biosciences (Madison, WI). Sequencing results were analyzed using Benchling. All Sanger sequencing products were generated with Q5 High-Fidelity polymerase (NEB), Phusion Hot Start Flex DNA polymerase (NEB), or OneTaq DNA polymerase (NEB). Diagnostic PCRs were performed with OneTaq DNA polymerase (NEB) or GoTaq DNA polymerase (Promega). Whole-plasmid sequencing was performed by Plasmidsaurus (Eugene, OR) when noted.