The largest database of trusted experimental protocols

Anti rarα antibody

Manufactured by Santa Cruz Biotechnology

The Anti-RARα antibody is a laboratory tool used for the detection and analysis of the retinoic acid receptor alpha (RARα) protein. RARα is a nuclear receptor that plays a role in the regulation of gene expression. The antibody can be used in various applications, such as Western blotting, immunohistochemistry, and immunoprecipitation, to study the expression, localization, and interactions of the RARα protein.

Automatically generated - may contain errors

2 protocols using anti rarα antibody

1

Silencing RARα and Regulating Tal2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
We used pSilencer 3.1-H1 (Life Technologies) as an shRNA vector. The sequences of the shRNA duplexes used RARα knockdown were as follows: RARα gene, sense 5′- GCAAGTACACTACGAACAACATTCAAGAGATGTTGTTCGTAGTGTACTTGCTTTTTTGGAA-3′ and antisense 5′- TTCCAAAAAAGCAAGTACACTACGAACAACATCTCTTGAATGTTGTTCGTAGTGTACTTGC-3′, no-target as a control, sense 5′-GTACTATTCGACACGCGAAGTTCAAGAGACTTCGCGTGTCGAATAGTACTTTTTTGGAA-3′ and antisense 5′-TTCCAAAAAAGTACTATTCGACACGCGAAGTCTCTTGAACTTCGCGTGTCGAATAGTAC-3′. Lipofectamine 2000 was used to transfect with each of these constructs into P19 cells. Western blotting probed with an anti-RARα antibody (Santa Cruz Biotechnology, CA) and anti-Beta-Actin antibody (Thermo SCIENTIFIC, CA) were performed to assess RARα knockdown. The influence of Tal2 expression by RARα suppression was examined by real-time PCR.
+ Open protocol
+ Expand
2

Antibody Optimization for Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary antibodies for Western blot analysis were as follows: anti-LOX1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA), anti-STRA6 antibody (ABGENT, San Diego, CA), anti-CRBP1 antibody (Santa Cruz Biotechnology), anti-RARα antibody (Santa Cruz Biotechnology), anti-RARγ antibody (Santa Cruz Biotechnology), anti-RXRα antibody (Santa Cruz Biotechnology), anti-c-Jun N-terminal kinase (JNK) antibody (Santa Cruz Biotechnology), anti-pJNK antibody (Abcam, Cambridge, MA), anti-p38MAPK antibody (ABGENT), anti-p-p38MAPK antibody (ABGENT), anti-pSmad2 antibody (Santa Cruz Biotechnology), anti-Smad2 antibody (Santa Cruz Biotechnology), anti-TGFβ1 (Santa Cruz Biotechnology), anti-caspase 3 antibody (Santa Cruz Biotechnology), anti-collagen 1 antibody (Santa Cruz Biotechnology), and anti-actin antibody (Millipore, Temecula, CA). Secondary antibodies for Western blot analysis as HRP-conjugate antibody were purchased from Millipore. The inhibitors of JNK, SP600125 and p38MAPK, SB203580 were purchased from Sigma-Aldrich (St. Louis, MO).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!