RNA was isolated using PureLink RNA Mini Kit (Thermo Fisher) and reverse transcribed with High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) according to manufacturer's instruction. cDNA samples were then applied to quantitative reverse transcriptase PCR with Power UP SYBR Green Master Mix (Thermo Fisher) and Rotor Gene Q-RT PCR system (Qiagen). The threshold cycle (CT) was determined, and the relative gene expression subsequently was calculated as follows: fold change = 2−Δ(ΔCT), where ΔCT = CT-CT target housekeeping (β-actin) and Δ(ΔCT) = ΔCT-CT treated control. Primer sequences are provided in Supplementary Table 1 .
Rotor gene q rt pcr system
Manufactured by Qiagen
Sourced in United States
The Rotor-Gene Q RT-PCR System is a real-time PCR cycler that can be used for a variety of applications, including gene expression analysis, pathogen detection, and DNA/RNA quantification. It features a 72-well rotor design and is capable of performing fast, sensitive, and reliable real-time PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Quantitect sybr green pcr kit, by Qiagen (4 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Rna midi kit, by Qiagen (2 mentions)
Transcriptor high fidelity cdna synthesis kit, by Roche (2 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions)
Rna mini kit, by Qiagen (1 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
Genejet genomic dna purification kit, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Rotor gene q software, by Qiagen (1 mentions)
Type it hrm pcr kit, by Qiagen (1 mentions)
8 protocols using rotor gene q rt pcr system
1
Relative Gene Expression Analysis
2
Quantitative PCR of Nrf2 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolation was carried out by RNA Mini Kit (Qiagen). The amount and purity of the RNA extracts were determined via Smartspec spectrophotometry (Bio-Rad). cDNA was synthesized by iScript cDNA Synthesis kit (Biorad) using 100 ng total RNA. Quantitative reverse transcriptase PCR was performed using Rotor Gene Q-RT PCR system (Qiagen), and QuantiTect PCR Sybr Green kit (Qiagen). PCR products were separated on 2.4% agarose gel in order to control the product base pair and the bands were extracted using QIAquick gel extraction kit (Qiagen). The dsDNA concentration of gel extractions were determined by spectrophotometry and 101–1010 dilutions prepared to study standard curve for quantitative analysis. The samples and the standard curve were obtained simultaneously in one run, and the results normalized to β-actin mRNA expression. The sequences of primers used were:
mouse Nrf2 forward, 5′-CTCGCTGGAAAAAGAAGTGG-3′;
mouse Nrf2 reverse, 5′-CCGTCCAGGAGTTCAGAGAG-3′;
mouse β-actin forward, 5′-AGCCATGTACGTAGCCATCC-3′;
mouse β-actin reverse, 5′-CTCTCAGCTGTGGTGGTGAA-3′.
3
CYP2C8 Polymorphism Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from leucocytes using a Gene-JET Genomic DNA Purification Kit (Thermo Scientific). The polymorphisms (rs10509681 and rs11572080) in the CYP2C8 gene were analyzed using TaqMan® Drug Metabolism assays (Applied Biosystems, USA) on a Rotor-Gene Q RT-PCR system (Qiagen, USA). DNA extraction and genotyping were performed following the same procedure described earlier (18 ).
4
qRT-PCR-based Gene Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The qRT-PCR-based quantification was done in triplicates and conducted on ROTOR-GENE Q RT-PCR system (Qiagen, United States) following the manufacturer’s instructions. Reaction mixture consisted of SYBER Green Master mix, diluted cDNA, and specific primer for the genes designed with Primer 3 software (Table 1 ) and cDNA. The conditions for qRT-PCR were 95°C for 10–12 min for initial denaturation, followed by 40 cycles of three steps of amplification 95°C (10 s), 66°C (10 s), and 72°C (15 s). All reactions were performed in triplicates using gene-specific primers and selecting actin gene as reference gene to normalize the data, and threshold cycle (Ct) values were used for calculation. Quantification of the relative gene expression of a gene was done by using 2–ΔΔct method (Livak and Schmittgen, 2001 (link); Awasthi et al., 2015 (link)).
5
Cardiac Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
100 mg of heart tissues was homogenized, and total RNAs were isolated with the RNA Midi Kit (QIAGEN) followed by reverse transcription using the Transcriptor High Fidelity cDNA Synthesis kit (ROCHE). Quantitative reverse transcriptase PCR was applied to cDNA with using the QuantiTect PCR Sybr Green kit (QIAGEN) and Rotor Gene Q-RT PCR system (QIAGEN). The threshold cycle (CT) was determined, and the relative gene expression subsequently was calculated as follows: fold change = 2−Δ(ΔCT), where ΔCT = CT − CT target housekeeping (β-actin) and Δ(ΔCT) = ΔCT − CT-treated control. The sequences of primers used to detect the expression of rabbit transcripts are listed in Supplementary Table 2 .
6
Quantitative RT-PCR analysis of aortic gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated with RNA Midi Kit (QIAGEN) from 200 mg of rabbit aorta. Smartspec spectrophotometry (BIO-RAD) was used for the determination of purity and amount of isolated RNA. cDNA was synthesized with Transcriptor High Fidelity cDNA Synthesis kit (ROCHE) using 100 ng total RNA. Quantitative reverse transcriptase PCR was applied to cDNA by using QuantiTect PCR Sybr Green kit (QIAGEN) and Rotor Gene Q-RT PCR system (QIAGEN). The results normalized to GAPDH mRNA expression results. The sequences of primers used were
rabbit JNK1 forward, 5'-GTGCTTTTCCCAGCTGACTC-3';
rabbit JNK1 reverse, 5'-ATCGTGTGTTCCCTTTCGTC-3';
rabbit c-jun forward, 5'-ACAGAGCATGACCCTGAACC-3';
rabbit c-jun reverse, 5'-TTGCTGGACTGGATGATGAG-3';
rabbit MMP-9 forward, 5'-AACACACACGACGTCTTCCA-3';
rabbit MMP-9 reverse, 5'-TGCAGGATGTCAAAGCTCAC-3';
rabbit GAPDH forward, 5'-GCGCCTGGTCACCAGGGCTGCTT-3';
rabbit GAPDH reverse, 5'-TGCCGAAGTGGTCGTGGATGACCT-3'.
7
Quantitative Analysis of Heat Shock Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment of fibroblast cells with hyperthermia, total RNA was isolated by RNeasy Mini Kit (Qiagen) as described in the manufacturer's protocol. 100 ng total RNA was used to obtain cDNA by using the iScript cDNA Synthesis kit (Biorad). Specific genes were amplified by using QuantiTect PCR Sybr Green kit (Qiagen) and Rotor Gene QRT-PCR system (Qiagen). The results were normalized to GAPDH mRNA expressions. The sequences of primers used were as follows: human HSP40 forward: TCCCAGACCCTGTACACTCC; human HSP40 reverse: TTGCTGGAGTCACTCACTGG; human HSP70 forward: AGCCAAGAAGGCAAAAGTGA; human HSP70 reverse: CCACTGCGTTCTTAGCATCA; human GAPDH forward: GATTTGGTCGTATTGGGCGC; and human GAPDH reverse: TTCCCGTTCTCAGCCTTGAC.
8
High-Resolution Melting Analysis of Rottboellia cochinchinensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RT-PCR reaction mixture (10 μl total volume) contained 5 μl of 2X HRM PCR master mix, including the ds-DNA-binding fluorescent EvaGreen dye (Type-it HRM PCR Kit, Qiagen, Hilden, Germany), forward (RottF) and reverse (RottR) primers (0.7 μl each of 10 μM working stocks), 2 μl genomic DNA, and 2.3 μl RNAse-free water. The reactions were set up in a Rotor-Gene Q RT-PCR system (Qiagen) under the following conditions: 95 C for 5 min, followed by 40 cycles of 10 s at 95 C, and then 30 s at 55 to 60 C. HRMA was performed immediately following the completion of PCR amplification. The temperature was raised from 65 to 85 C at 0.1 C increments with a 2-s hold time for each acquisition step. Rotor Gene Q software (Qiagen) was used to set up the sample arrangement, to define PCR conditions, for monitoring the amplification in real time, and for viewing and analyzing the melting curves.
To study the ability of the HRMA assay to detect heterozygous variants present in an R. cochinchinensis population, artificial heterozygotes (heteroduplex) were created by mixing PCR products (post-PCR mixing) of wild-type and mutant homozygotes using a mixing ratio of 1:1 (Cheng et al. 2011) to simulate heterozygous genotype. All three genotypes were subjected to HRMA as described earlier.
To study the ability of the HRMA assay to detect heterozygous variants present in an R. cochinchinensis population, artificial heterozygotes (heteroduplex) were created by mixing PCR products (post-PCR mixing) of wild-type and mutant homozygotes using a mixing ratio of 1:1 (Cheng et al. 2011) to simulate heterozygous genotype. All three genotypes were subjected to HRMA as described earlier.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!