For real-time polymerase chain reaction (RT-PCR), rats were fully anesthetized with urethane (intraperitoneal injection, 4 g/kg) and transcardially perfused with heparinized saline. Tissues of bladder, L6–S1 spinal cord, and DRG were rapidly collected. Since DRG is very small, bilateral DRGs were combined to provide adequate tissue for total RNA extraction. To ensure rapid purification of high-quality RNA, tissue lapping instrument (TissueLyser II, QIAGEN, Germany) with TRIzol (Life Technologies, Germany) was used for homogenization, and RNeasy mini kit was used for total RNA extraction. The quality and concentration of RNA were determined by ultraviolet spectrophotometry. Using a qPCR RT kit (TOYOBO, Japan), total RNA was reverse transcribed into cDNA. The cDNA was then amplified using the RT-PCR kit (Takara, Japan) with a Real Time system (Eppendorf, Germany). The special primers used for TREK-1 were as follows: CACCATTGGATTTGGCGATT (sense) and CAACGAGGATCCAGAACCACA (reverse). Cycle amplifications included 95°C for 30 s (1 cycle), 95°C for 5 s and 60°C for 30 s (40 cycles). β-actin expression was used as an internal control.
Real time system
Manufactured by Eppendorf
Sourced in Japan
The Real Time system is a laboratory instrument designed for real-time monitoring and analysis of various biological and chemical processes. It provides precise, accurate, and reliable measurements in real-time, enabling researchers to monitor and track changes in their samples or reactions in a continuous manner.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using real time system
1
Quantifying TREK-1 Expression in Rats
2
Quantification of Efflux Pump Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three different efflux pump‐encoding genes, adeB, abeM, and amvA, were analyzed by quantitative reverse transcriptase–PCR (qRT‐PCR). The primers used for qRT‐PCR analysis are listed in Table 1 . Gene expression was determined by qPCR using the TransStart SYBR Green qPCR SuperMix UDG Kit (TransGen Biotech). A no‐template control was included in the analysis. RpoB was used as the reference gene. Relative expression was determined using the 2−ΔΔCt method with the Eppendorf Real‐Time System. Reaction samples were prepared according to the manufacturer's instructions with a 10‐fold dilution of cDNA. All reactions were carried out in triplicate with at least two biological replicates. Target gene expression was measured as the relative expression compared to that of rpoB.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!