Jurkat Clone E6-1 cells (ATCC, Manassas, VA), which are acute leukemia T cells from a human male, were maintained in RPMI-1640 (ATCC, Manassas, VA) with 10% FBS (HyClone, Logan, UT) and 1% Penicillin (Mediatech Inc., Herndon, VA) in T-flasks (Sarstedt Inc., Newton, NC) at 37 °C with 5% CO2.
Jurkat cells clone e6 1
Manufactured by American Type Culture Collection
Sourced in United States
Jurkat cells (clone E6-1) are a well-established human T lymphocyte cell line derived from an acute T cell leukemia. This cell line is widely used in immunological and cell signaling research.
Automatically generated - may contain errors
Lab products found in correlation
Rpmi 1640, by Thermo Fisher Scientific (2 mentions)
Penicillin, by Corning (1 mentions)
Rpmi 1640, by American Type Culture Collection (1 mentions)
T flasks, by Sarstedt (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Sodium pyruvate, by Thermo Fisher Scientific (1 mentions)
L glutamine, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Hepes, by Thermo Fisher Scientific (1 mentions)
Tryple express, by Thermo Fisher Scientific (1 mentions)
Mycoalert plus detection kit, by Lonza (1 mentions)
Lenti x hek293t, by Takara Bio (1 mentions)
Skov3, by American Type Culture Collection (1 mentions)
Trichloroacetic acid, by Merck Group (1 mentions)
Human il 2 elisa kit, by BioLegend (1 mentions)
Kynurenine, by Merck Group (1 mentions)
Ionomycin, by InvivoGen (1 mentions)
Ficoll paque plus, by GE Healthcare (1 mentions)
Tib 152, by American Type Culture Collection (1 mentions)
11 protocols using jurkat cells clone e6 1
1
Jurkat Cell Culture Protocol
2
Cell Culture Protocols for Lenti-X HEK293T, K562, and Jurkat Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lenti-X HEK293T (Clontech) cells were cultured in DMEM (Gibco) with L-glutamine and sodium pyruvate supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin (Gibco) and passaged using TrypLE Express (Gibco). K562 (American Type Culture Collection (ATCC), CCL-238) was cultured in RPMI 1640 (Gibco) with L-glutamine supplemented with 10% FBS and 1% penicillin-streptomycin. Jurkat clone E6-1 cells (ATCC, TIB-152) were cultured in RPMI 1640 with L-glutamine (Gibco) supplemented with 10% FBS, 10 mM HEPES (Gibco), 1 mM sodium pyruvate (Gibco) and 1% penicillin-streptomycin. Cells were routinely tested for mycoplasma using a MycoAlert PLUS Detection Kit (Lonza) and found to be negative.
3
Assessing T Cell Activation and Kynurenine Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SKOV-3 and Jurkat clone E6-1 cells were purchased from ATCC and cultured according to manufacturer's instructions.
Trichloroacetic acid, Ehrlich's Reagent (4-(Dimethylamino)benzaldehyde and kynurenine were purchased from Sigma. IFNγ was acquired from ThermoFisher Scientific.
Detection Reagent Solution was prepared by dissolving Ehrlich's Reagent in acetic acid at 20 mg per 1 mL.
Human IL-2 ELISA kit was purchased from BioLegend. 20 μL of each media sample from the functional assay was used for analysis in the ELISA according to the manufacturer's instructions.
The final concentration of DMSO in the cell culture should not exceed 0.3% for the kynurenine assay and 0.2% for the co-culture functional (Jurkat T cell activation) assay.
Trichloroacetic acid, Ehrlich's Reagent (4-(Dimethylamino)benzaldehyde and kynurenine were purchased from Sigma. IFNγ was acquired from ThermoFisher Scientific.
Detection Reagent Solution was prepared by dissolving Ehrlich's Reagent in acetic acid at 20 mg per 1 mL.
Human IL-2 ELISA kit was purchased from BioLegend. 20 μL of each media sample from the functional assay was used for analysis in the ELISA according to the manufacturer's instructions.
The final concentration of DMSO in the cell culture should not exceed 0.3% for the kynurenine assay and 0.2% for the co-culture functional (Jurkat T cell activation) assay.
4
Generation of NR4A1 TCR Reporter Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To create the NR4A1_NeonGreen TCR reporter, the coding sequence of mNeonGreen was integrated in-frame into the NR4A1 locus before the stop codon using CRISPR-induced homology directed repair (43 (link)). The mNeonGreen coding sequence (44 (link)) (IDT, Coralville IA) flanked by a 5’ 334bp homology arm, 5’ T2A element and a 315bp 3’ homology arm was electroporated with recombinant spCas9 (IDT) and NR4A1 CRISPR guide RNA (IDT, sequence: AUGAAGAUCUUGUCAAUGAU) into Jurkat clone E6-1 cells (ATCC). Cells were cloned by limiting dilution and the clone with the highest signal upon PMA (5ng/ml) - ionomycin (5μg/ml) (Invivogen) stimulation was identified. The obtained reporter cell line was further modified by CRISPR knock out of TRA/TRB expression (gRNA sequences: AGAGUCUCUCAGCUGGUACA, CAAACACAGCGACCUUGGGU (IDT)); cells with successful knock out were sorted for lack of CD3 expression. The final NR4A1_NeonGreen TCR reporter showed upregulation of the reporter signal according to TCR signal strength, mimicking regulation of the endogenous NR4A1 locus (45 (link)).
5
Isolation and Immortalization of Primary Human T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T/17 and Jurkat cells (clone E6‐1) were purchased from ATCC (CRL‐11268 and TIB‐152). Primary skin fibroblasts from an affected Fabry patient and related healthy control were obtained from the Coriell Institute (GM02775 and GM02270) and immortalized by introduction of SV40 large T antigen and TERT (Viral Vector Core, Blood Research Institute, Versiti, WI USA). HDo CD4+ T cells were isolated by positive selection using magnetic‐activated cell sorting (MACS; Miltenyi Biotec 130‐045‐101) per the manufacturer's instructions from leukapheresis packs (PPA Research 10‐0001 or StemCell Technologies 70500) after centrifugation over a Ficoll‐Paque PLUS (GE Healthcare 17144002) density barrier. FDo peripheral blood mononuclear cells (PBMCs) were enriched from discarded (i.e., the CD34+‐depleted) fraction of de‐identified clinical cell product (Khan et al, 2021 (link)) by density centrifugation using NycoPrep 1.077 solution (Axis‐Shield 1114550). CD4+ T cells were obtained from PBMCs by positive selection for CD4 using magnetic‐activated cell sorting (MACS) as with HDo cells.
6
Jurkat Cell Lysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Jurkat cells (clone
E6-1) were purchased from ATCC and grown in RPMI-1640 medium supplemented
with 10% FBS. The cells were maintained in a 5% CO2, water-saturated
environment at 37 °C. The cells were centrifuged (300 rcf ×
5 min), and the supernatant was removed. The cell pellet was resuspended
in PBS (5 mL), centrifuged (300 rcf × 5 min), and the supernatant
was removed. This process was repeated one more time, after which
the cell pellet was frozen at −80 °C until cell lysis.
For cell lysis, Jurkat cells (1 × 106 cells) were
resuspended in 100 μL of 10 mM N-(2-hydroxyethyl)piperazine-N′-ethanesulfonic acid buffer (pH 7.3) and flash-frozen
in liquid nitrogen. The cell suspensions were thawed and then flash-frozen
again in liquid nitrogen. This process was repeated one more time,
after which the cell suspension was centrifuged (14 000 rpm
× 10 min) at 4 °C. The supernatant was removed and stored
at −80 °C until further use.
E6-1) were purchased from ATCC and grown in RPMI-1640 medium supplemented
with 10% FBS. The cells were maintained in a 5% CO2, water-saturated
environment at 37 °C. The cells were centrifuged (300 rcf ×
5 min), and the supernatant was removed. The cell pellet was resuspended
in PBS (5 mL), centrifuged (300 rcf × 5 min), and the supernatant
was removed. This process was repeated one more time, after which
the cell pellet was frozen at −80 °C until cell lysis.
For cell lysis, Jurkat cells (1 × 106 cells) were
resuspended in 100 μL of 10 mM N-(2-hydroxyethyl)piperazine-N′-ethanesulfonic acid buffer (pH 7.3) and flash-frozen
in liquid nitrogen. The cell suspensions were thawed and then flash-frozen
again in liquid nitrogen. This process was repeated one more time,
after which the cell suspension was centrifuged (14 000 rpm
× 10 min) at 4 °C. The supernatant was removed and stored
at −80 °C until further use.
7
Establishing Latent HIV Cell Lines
8
Jurkat Cell Culture Protocol
9
Cell Culture Conditions of Common Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The EBV+ C666.1 human NPC cell line was purchased from Shunran Biology (Shanghai, China). Prof. Reinhard Zeidler (Ludwig-Maximilians-University Munich, Germany) kindly provided the PCI-1 human oropharyngeal cancer cell line. C666.1 and PCI-1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Nobimpex, Herbolzheim, Germany). The K562 human chronic myeloid leukemia cell line and the EBV+ KATO-III human gastric cancer cell line were purchased from the American Type Culture Collection (ATCC, Manassas, VA) and cultured in Iscove’s modified Dulbecco’s medium (IMDM; Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% FBS. Jurkat cells (Clone E6-1) were obtained from ATCC and cultured in Roswell Park Memorial Institute (RPMI, Thermo Fisher Scientific, Waltham, MA, USA) + 10% FBS. 293T cells were obtained from ATCC, and cultured in DMEM + 10% FBS. All cell lines were cultured at 37oC and 5% CO2.
10
Cell Culture Conditions for Immunology Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MC57G and Jurkat cells (clone E6-1) were obtained from ATCC. Raji cells and 293T cells were provided by J. Lieberman (Boston Children’s Hospital, Boston, MA), and N. Hacohen (Massachusetts General Hospital, Boston, MA), respectively. Raji and Jurkat cells were cultured in RPMI-1640 supplemented with 10% FBS, 2 mM l -glutamine, 50 µM β-mercaptoethanol (β-ME), 10 U/ml penicillin/streptomycin, 1 mM sodium pyruvate, and 100 mM Hepes. MC57G and 293T cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 2 mM l -glutamine, 10 U/ml penicillin and streptomycin, and 1 mM sodium pyruvate. All cell culture reagents were obtained from Life Technologies unless otherwise noted.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!