CHIP and following qPCR were performed using Agarose ChIP Kit (Thermo Fisher Scientific, California, USA) or ChIP-IT® Express Enzymatic CHIP Kit (Active Motif, Carlsbad, USA) according to manufacturers' instructions. Chip-grade primary antibodies against E2F7 (Santa Cruz biotechnology, USA) and E2F1 (Cell Signaling Technology, MA, USA) were used in the chip experiments and a normal rabbit IgG (Santa Cruz biotechnology, USA) was served as a negative control. DLEU2 promoter chip promoter: F. GCGGGGTTGGCTCTAACGAAT; R. GGTTATCCTGTCTCTCCCGCT
Agarose chip kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Agarose ChIP Kit is a tool used for chromatin immunoprecipitation (ChIP) experiments. It provides the necessary reagents and protocols to isolate and purify DNA fragments bound to specific proteins of interest from a cell or tissue sample.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Ab4441, by Abcam (1 mentions)
Ab3594, by Abcam (1 mentions)
Ab12193, by Abcam (1 mentions)
Ab8580, by Abcam (1 mentions)
Sc 13067, by Abcam (1 mentions)
Sybr premix ex taqtm, by Takara Bio (1 mentions)
Anti p65 d14e12, by Cell Signaling Technology (1 mentions)
Smad2 3 antibody, by Cell Signaling Technology (1 mentions)
Igg isotype control, by Cell Signaling Technology (1 mentions)
Scientz iid sonicator, by Ningbo Scientz Biotechnology (1 mentions)
Millipore chip assay kit, by Merck Group (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Ab171870, by Abcam (1 mentions)
Glycine, by Thermo Fisher Scientific (1 mentions)
Ab227269, by Abcam (1 mentions)
Formaldehyde, by Beyotime (1 mentions)
15 protocols using agarose chip kit
1
Chromatin Immunoprecipitation and qPCR Analysis
2
ChIP Assay with NFAT1 Antibody
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP assay was performed using the Agarose ChIP Kit (Thermo) following the manufacturer’s instructions. Anti-NFAT1 or immunoglobulin G (IgG) antibody were added to the supernatant and incubated overnight at 4 °C. The DNA fragments were released from the bound chromatin after crosslinking and micrococcal nuclease digestion, immunoprecipitated, and finally eluted in 50 μL of DNA column elution solution. The primers used for the qPCR in this study are listed in Table S2 .
3
Chromatin Immunoprecipitation Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation assays were carried out using the Agarose ChIP kit from Thermo Scientific, according to the manufacturer’s guidelines. Briefly, cell samples were crosslinked by 1% formaldehyde for 10 min, and the reaction was stopped by the addition of glycine to a 125 mM final concentration. The fixed cells were lysed in SDS buffer, and the chromatin was fragmented by microccocal nuclease digestion. The sheared chromatin was incubated with antibodies against DOT1L (Bethyl, A300-954A; dilution 1:50), GCN5 (Santa Cruz, sc-20698; dilution 1:20), H3K4me3 (Abcam, ab8580; dilution 1:100), H3K9ac (Abcam, Ab4441; dilution 1:125), H3K79me2 (Abcam, Ab3594; dilution 1:100), EP300 (Abcam, ab14984, clone 3G230/NM-11), PPARGC1A (Santa Cruz, sc-13067; dilution 1:20), SIRT1 (Abcam, Ab12193; dilution 1:100) and recovered by binding to protein A/G agarose. Eluted DNA fragments were used directly for qPCR. Primers used for ChIP-qPCR analysis are listed in Supplementary Table 4 .
4
Chromatin Immunoprecipitation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation was carried out using agarose ChIP kit (Thermo Scientific, USA) according to the manufacturer’s instructions. Immunoprecipitation was performed with 1 µg of each antibody or negative control IgG. Real-time PCR was performed on the purified DNA and input DNA using SYBR Premix ExTaqTM (TAKARA, Japan) by StepOnePlus real-time PCR system (Thermo Fisher Scientific, USA). The primer sequences are provided in Supplementary Table 5 . The results were computed as percent antibody bound per input and data were displayed after subtracting control IgG values. Data from three independent experiments were collected, and mean value and standard deviation (SD) were presented.
5
Chromatin Immunoprecipitation Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pierce Agarose ChIP Kit (Thermo; USA) was used to perform ChIP assays. Firstly, rKyse150 cells were cross-linked and lysed, and chromatin was sheared. Sheared chromatin-DNA mixture was then incubated with 4 μl IgG as negative control, 2 μl RNA polymerase II antibody as positive control, 5 μl beta-catenin (GTX; USA) and 5 μl TCF4 (Cell Signaling; USA) antibody overnight at 4 °C. PCR was amplified using eight primers shown in Supplementary Table S4 .
6
NF-κB Binding Evaluation in IFN-γ Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed with an Agarose ChIP kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. In brief, 107 of BM cells were fixed and immunoprecipitated with either anti-p65 (D14E12; Cell Signaling Technology) or rabbit IgG (Thermo Fisher Scientific) antibodies. Immunoprecipitated DNA fragments were quantified by real-time PCR with the use of the following primers, which amplify the IFN-γ promoter region containing NF-κB–binding sites: forward, 5′-ACCCTGAGTGATTTGTAGTAGGT-3′; and reverse, 5′-GTGAATTTCTCATCCACAGAGCA-3′. Fold enrichment was normalized to rabbit IgG–precipitated samples.
7
HNF4α Chromatin Immunoprecipitation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment with 6-G for 24 hours, Hepa1–6 cells were exposed to formaldehyde 1% for 10 minutes, and washed with phosphate-buffered saline. A ChIP assay was performed with the agarose ChIP kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. Digested chromatin was incubated overnight with 4 μg anti-HNF4α. After DNA recovery, both eluted and total input samples were used in real-time PCR for the quantification of protein-bound DNA. Primers were designed to span an approximately 130-bp region of the putative HNF4α binding site. Primer sequences were as follows: forward: 5'-GTGATGTAGAGTTTTAGC-3' and reverse: 5'-CAGGATCTCTAACTA-3'
8
Chromatin Immunoprecipitation Assay for NF-κB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the stimulation, the ChIP assay was performed using an Agarose ChIP Kit (Thermo Fisher Scientific, 26156) according to the manufacturer’s instructions. In brief, the chromatin was cross-linked by 1% formaldehyde and digested by micrococcal nuclease. The lysate was incubated with rabbit anti-NF-κB p65 at 4 °C overnight followed by incubation with ChIP Grade Protein A/G Plus Agarose. The purified DNA was analyzed by PCR assay using primers targeting mouse COX2 promoters: sense 5′-CCCGGAGGGTAGTTCCATGAAAGACTTCAAC-3′ and antisense 5′-GGTGGAGCTGGCAGGATGCAGTCCTG-3′. The primers targeting the GAPDH promoter served as a positive control. PCR products obtained after 40 cycles were separated on 2% agarose gels.
9
Investigating SMAD2/3 Binding in PLC-8024 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PLC-8024 cells were treated with rGDF1 at 50 ng/mL or rTGF-β1 at 10 ng/mL or vehicle control for 30 min. The cells were washed twice with cold PBS and cross-linked in 16% formaldehyde (w/v) at room temperature for 10 min. Then, the cells were resuspended in glycine solution (10×) to a final concentration (1×). After washing with cold PBS, cells were collected by centrifugation at 3000 g for 5 min. Cell lysis and MNase digestion were performed using the Agarose chip kit (Thermofisher, US) according to the manufacturer’s standard protocols. Supernatants were incubated with SMAD2/3 antibodies (Cell Signalling Technology, 8685) or isotype control IgG (Cell Signalling Technology, 2729) overnight at 4°C. Protein A/G beads were used to capture antibody-DNA complexes, and the DNA was purified and detected by qPCR analysis. Primers used in chip-qPCR analysis were listed in Supplementary Table 4 .
10
CHIP Assay for Transcription Factor Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHIP assays were performed using an Agarose CHIP Kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions. Briefly, cells transfected with pcDNA4.0-Maf1 or pcDNA4.0-p65 plasmids were harvested, cross-linked by 1% formaldehyde for 10 min, and then treated with glycine for 5 min to stop the cross-linking. Nuclear lysates were sonicated for 20 min using a Scientz-IID sonicator (Scientz, Zhejiang, China). Immunoprecipitation was conducted with specific antibodies (anti-Maf1, anti-p65) or isotype IgG antibodies. Following proteinase K digestion, bound target DNA fractions were amplified for a region that spanned nucleotides containing the Maf1 or p65 binding sites of the NLRP3 promoter.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!