7500 fast system sds software

Manufactured by Thermo Fisher Scientific

Sourced in United States

The 7500 Fast System SDS software is a comprehensive software solution designed for use with the 7500 Fast Real-Time PCR System. The software provides intuitive tools for data analysis, experiment design, and report generation, enabling efficient and reliable real-time PCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

29 protocols using 7500 fast system sds software

Quantitative Analysis of Kidney RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the kidney samples using Trizol (Invitrogen, CA, USA). The total RNA concentration and RNA purity were determined by measuring the OD260/OD280 ratio of each sample. RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega, USA). Primers for PCR (Table 1) were designed and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). mRNA transcripts encoding TGFβ1, TGFβ-R1, α-SMA, and E-cadherin were detected via real-time PCR using a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The PCR products were analysed using 7500 Fast System SDS software (Thermo Fisher Scientific).Table 1

PCR sequences and PCR products

Name	Size	Forward Primer (5′–3′)	Reverse Primer (5′–3′)
TGF-β1	493 bp	TCCCTCAACCTCAAATTATTCA	GCGGTCCACCATTAGCAC
TGFβ-R1	172 bp	GGCGAAGGCATTACAGTGTT	TGCACATACAAATGGCCTGT
α-SMA	322 bp	GGTGCTGTCTCTCTATGCCTCTGGA	CCCATCAGGCAACTCGATACTCTTC
E-cadherin	192 bp	AGACAGGGGTGGAGGAAGTT	GGGCAGGAGTCTAGCAGAAG
β-actin	243 bp	GAAATCGTGCGTGACATTAAGG	CACGTCACACTTCATGATGGAG

Yi Y.E., Li S.Y., Nie Y.N., Jia D.X., Zhang Z.H., Wang Y.F, & Wang Q. (2016). Effect of astragalus injection on renal tubular epithelial transdifferentiation in type 2 diabetic mice. BMC Complementary and Alternative Medicine, 16, 222.

+ Open protocol

+ Expand

DNA Isolation and SNP Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was isolated by using the QIAamp DNA Blood Mini Kit (Qiagen), according to the manufacturer's protocol. Single nucleotide polymorphism (SNP) genotyping of rs6927172 (for SNP details, see Fig E1 in this article's Online Repository at www.jacionline.org) was performed with TaqMan SNP Genotyping Assays on an ABI 7500 System, according to the manufacturer's instructions, by using the SNP rs6927172 assay C_1575580_10 (Thermo Fisher Scientific). PCR results were analyzed with 7500 Fast System SDS software (version 1.5; Thermo Fisher Scientific).

Urbano P.C.M., Aguirre-Gamboa R., Ashikov A., van Heeswijk B., Krippner-Heidenreich A., Tijssen H., Li Y., Azevedo V.F., Smits L.J.T., Hoentjen F., Joosten I, & Koenen H.J.P.M. (2018). TNF-α-induced protein 3 (TNFAIP3)/A20 acts as a master switch in TNF-α blockade-driven IL-17A expression. The Journal of allergy and clinical immunology, 142(2).

+ Open protocol

+ Expand

Quantifying Relative eGFP Copy Numbers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Relative eGFP gene copy numbers were measured by fluorescence quantitative PCR (qPCR). Genomic DNA was extracted from stable cells according to the manufacturer's instructions (TaKaRa, Dalian, China). The primers used for the fluorescence qPCR were as follows: eGFP, F1, 5′‐CTACGTCCAGGAGCGCACCATCT‐3′ and R1, 5′‐GTTCTTCTGCTTGTCGGCCATGATAT‐3′. The glyceraldehyde phosphate dehydrogenase (GAPDH) gene was used as an internal reference, and the primer sequences were as follows: F1, 5′‐CGACCCCTTCATTGACCTC‐3′ and R1, 5′‐CTCCACGACATACTCAGCACC‐3′. qPCRs were performed using the ABI 7500 SYBR Fluorescence quantitative PCR instrument (Applied Biosystems, Foster City, CA, USA), and 7500 Fast System SDS Software was used to analyse the results. The cycling parameters were as follows: 95°C for 3 min.; and 35 cycles of 94°C for 30 sec., 50°C for 30 sec. and 72°C for 30 sec. The qPCRs were performed using the Platinum SYBR Green qPCR SuperMix‐UDG Kit (Invitrogen). The 2^−ΔΔCt method was used to calculate the relative eGFP copy numbers.

Tian Z., Xu D., Wang T., Wang X., Xu H., Zhao C, & Xu G. (2017). Identification of a potent MAR element from the human genome and assessment of its activity in stably transfected CHO cells. Journal of Cellular and Molecular Medicine, 22(2), 1095-1102.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis of Lung Tissue

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lungs were homogenized using a TissueLyser LT (Qiagen) and total RNA was extracted from the lung tissue supernatant using RNeasy Mini kit (Qiagen). RNA extraction from sorted lung cells was performed using Trizol (Invitrogen). Following the chloroform step, the aqueous phase containing RNA was further processed using the RNeasy Mini or Micro Kit according to manufacturer’s instructions (Qiagen). RNA concentration was determined by NanoDrop (Thermo Scientific). In all, 2 μg or 9 μl (sorted cells) of RNA was converted to cDNA using High Capacity RNA-to-cDNA kit (Applied Biosystems). RT-qPCR was performed with Quantitect Probe PCR Master Mix (Qiagen). For mRNA analysis of Gapdh, Cxcl1, Cxcl2, Il6, Csf2, and Ifna5 gene specific primers and probes were used (all Applied Biosystems). For absolute quantification of RSV L gene, TNF-α and IFN-γ mRNA, the exact number of copies of the gene of interest was calculated using a plasmid DNA standard curve for each gene and normalized to Gapdh.^{21 (link)} RT-qPCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems). To quantify relative mRNA expression the mean ΔCT was calculated for each target gene relative to Gapdh (encoding glyceraldehyde-3-phosphate dehydrogenase) and expressed as 2^−ΔCT. Analysis was performed using 7500 Fast System SDS Software (Applied Biosystems).

Kirsebom F.C., Kausar F., Nuriev R., Makris S, & Johansson C. (2019). Neutrophil recruitment and activation are differentially dependent on MyD88/TRIF and MAVS signaling during RSV infection. Mucosal Immunology, 12(5), 1244-1255.

+ Open protocol

+ Expand

Genetic Variant Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA extraction was performed with a MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics, Indianapolis, Indiana, USA) using Magna Pure LC 2.0® equipment from Roche. DNA samples were stored at −20 °C until analysis.
Genetic analysis was performed to assess four clinically relevant variants of the ABCB1 gene (rs3789243, rs1128503, rs2032582, and rs1045642), two variants of the CES1 gene (rs71647871 and rs2307243), one variant of the SLC15A1 gene (rs2297322), and one variant of the NEU2 gene (rs2233385). Allelic discrimination by real-time PCR was performed with specific primers and TaqMan® probes. Approximately 50 ng of genomic DNA was added to a master mix (Applied Biosystems, Foster City, CA, USA) that contained 200 nmol of primers and 40 nmol of probes for each polymorphism. Samples were placed in a 96-well plate and amplified as follows: pre-PCR read at 60 °C for 30 s, then 10 min at 95 °C, followed by 50 cycles of 95 °C for 15 s, and 60 °C for 1 min. Post-read analyses were performed at 60 °C for 30 s. All assays were carried out in a 7500 Fast PCR System (Applied Biosystems), and analyses were performed with 7500 Fast System SDS software.

Bermúdez de León M., León-Cachón R.B., Silva-Ramírez B., González-Ríos R.N., Escobedo-Guajardo B., Leyva-Parra R., Tovar-Cisneros B., González-González E., Alvarado-Díaz A., Vázquez-Monsiváis O., Mata-Tijerina V., Puente-Lugo L., Álvarez-Galván E., Currás-Tuala M.J., Aguado-Barrera M., Castorena-Torres F., Alcocer-González J.M., Elizondo G, & Salinas-Martínez A.M. (2020). Association study of genetic polymorphisms in proteins involved in oseltamivir transport, metabolism, and interactions with adverse reactions in Mexican patients with acute respiratory diseases. The Pharmacogenomics Journal, 20(4), 613-620.

+ Open protocol

+ Expand

Quantitative Assessment of Gene Expression in Immune Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified using the RNeasy Mini Kit (Qiagen Co., Strasse, Germany), according to the supplier’s instructions, followed by cDNA synthesis using reverse transcription with the Super-Script First-Strand cDNA Synthesis System (Invitrogen, Carlsbad, CA, USA) in a thermocycler Verity (Applied Biosystems, Foster City, CA, USA). Then, the cDNA was used to evaluate gene expression by real-time qPCR using TaqMan pre-designed assays for LL37 (CAMP, Hs00189038_m1-FAM), VDR (Hs01045840_m1-FAM), CYP27B1 (Hs00168017_m1-FAM), and ribosomal RNA 18S (rRNA 18S-VIC) (Thermo-Applied Biosystem). Amplification was performed in a StepOne Plus Real-Time PCR System (Applied Biosystems), and the data were analyzed with the 7500 Fast System SDS software (Applied Biosystems). The expression level results for each gene were estimated by the comparative ∆∆CT method, using the medium as a calibrator, or reported as relative to 18S.

Herrera M.T., Juárez E., Guzmán-Beltrán S., Torres M., Luna-Morales V.A., Villalana-Alvarez L.D, & González Y. (2022). High Vitamin D Concentrations Restore the Ability to Express LL37 by M. tuberculosis-Infected Human Macrophages. Biomolecules, 12(2), 268.

+ Open protocol

+ Expand

Quantification of Lung Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lung tissue was homogenized using a TissueLyser LT (Qiagen), and total RNA was extracted using RNeasy Mini kit including DNA removal (Qiagen) according to the manufacturer’s instructions. 1-2 μg of RNA was reverse-transcribed using the High Capacity RNA-to-cDNA kit according to the manufacturer’s instructions (Applied Biosystems). qPCR was performed to quantify lung RNA levels. To quantify Ifng, Tnfa and L gene primers and FAM-TAMRA probes previously described were used^{22 (link)}. The absolute number of gene copies was calculated using a plasmid DNA standard curve and the results were normalized to levels of Gapdh (Applied Biosystems). For relative quantification, the expression of Adora2a, Adora2b, Adora3 Cd200, Cd200r1, Cxcl1, Cxcl10, Ifna5, Il1b, Il6, Il28b Sftpa1, Sftpc, Sftpd, Tlr7 (all from Applied Biosystems run with the mastermix QuantiTech Probe PCR kit (Qiagen)) and influenza NP gene (primers from ref^{59 (link)} run with SYBR green master mix (Thermo Fisher)) were expressed relatively to the expression of Gapdh. First, the ΔCT (Ct = cycle threshold) between the target gene and the Gapdh for each sample was calculated. Then the expression was calculated as 2^-ΔCt. Analysis was performed using 7500 Fast System SDS software (Applied Biosystems).

Makris S, & Johansson C. (2020). R848 or influenza virus can induce potent innate immune responses in the lungs of neonatal mice. Mucosal immunology, 14(1), 267-276.

+ Open protocol

+ Expand

Quantifying RSV and Inflammatory Genes in Lungs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction from lung tissue was performed using Trizol (Invitrogen) according to manufacturer’s instructions. One microgram of RNA was reverse-transcribed using a High Capacity RNA-to-cDNA kit according to manufacturer’s instructions (Applied Biosystems). To quantify mRNA levels in lung tissue quantitative RT-PCR was performed. RT-PCR reactions for Areg (Amphiregulin), Il1a, Il1b, Cxcl9, Cxcl10 (Applied Biosystems) and RSV L gene23 (link) were performed using the Quantitect Probe PCR Master Mix (Qiagen) and the 7500 Fast Real-time PCR System (Applied Biosystems). For absolute quantification of RSV L gene, the exact number of copies of the gene was calculated using a plasmid DNA standard curve and then normalised to levels of Gapdh, a housekeeping gene (Applied Biosystems). For relative quantification, the expression of Areg, Il1a, Il1b, Cxcl9 and Cxcl10 was expressed relatively to the expression of Gapdh. First, the ΔCt (Ct = cycle threshold) between the target gene and Gapdh for each sample was calculated, following the calculation of 2^−ΔCt. Analysis was performed using 7500 Fast System SDS Software (Applied Biosystems).

Goritzka M., Pereira C., Makris S., Durant L.R, & Johansson C. (2015). T cell responses are elicited against Respiratory Syncytial Virus in the absence of signalling through TLRs, RLRs and IL-1R/IL-18R. Scientific Reports, 5, 18533.

+ Open protocol

+ Expand

Quantifying RSV Infection in Mouse Lungs

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lungs were homogenized using a TissueLyser LT (Qiagen) and total RNA was extracted from the lung tissue supernatant using RNeasy Mini kit (Qiagen). RNA concentration was determined by NanoDrop (Thermo Scientific). 2 µg of RNA was converted to cDNA using High Capacity RNA-to-cDNA kit (Applied Biosystems). RT-qPCR was performed with Quantitect Probe PCR Master Mix (Qiagen). RSV L gene mRNA was quantified as previously described^{12 (link)}. For exact quantification, copy numbers were calculated from a plasmid DNA standard curve and normalized to Gapdh (encoding glyceraldehyde-3-phosphate dehydrogenase). For mRNA analysis of Gapdh, Cxcl1, Cxcl2, Cxcl12, Il1a, Il1b, Il33, Areg, Ptgs2, Muc5ac gene specific primers and probes were used (all Applied Biosystems). RT-qPCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems). To quantify relative mRNA expression the mean ΔCT was calculated for each target gene relative to Gapdh and expressed as 2^−ΔCT. Analysis was performed using 7500 Fast System SDS Software (Applied Biosystems).
Live virus was quantified in the lungs by immunoplaque assay as previously described^{12 (link),36 (link)}.

Kirsebom F., Michalaki C., Agueda-Oyarzabal M, & Johansson C. (2020). Neutrophils do not impact viral load or the peak of disease severity during RSV infection. Scientific Reports, 10, 1110.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

H295R cells were cultured under normal growth and starvation conditions and total RNA was isolated using the TRIzol method according to the manufacturer’s instructions (Invitrogen Life Technologies, Carlsbad, CA, USA). RNA was reverse-transcribed to cDNA using the Improm RNA transcriptase kit (Promega) as previously described12 (link)71 (link). qRT-PCR analysis was performed on the 7500-Fast real-time PCR System (Applied Biosystems, Foster City, CA, USA) using ABsolute SYBR Green Mix (ABgene; Thermo Fisher scientific, Waltham, MA, USA). Briefly, qRT-PCR was performed in 96 well plates using 50 ng/well cDNA and 1 μl (20 pmol/μl) specific primers (Microsynth, Balgach, Switzerland) in a total volume of 25 μl. The cyclophilin A gene was used as endogenous control. Specific primer sequences may be found in Supplementary Table S1. Fold change in gene expression for a particular gene was calculated by the 2^−ΔΔCt method72 (link)73 (link). Amplification curves and the mean cycle threshold (Ct) values were calculated using the 7500 Fast System SDS software (Applied Biosystems), and correction for the endogenous gene, ΔCt and ΔΔCt were calculated as previously described12 (link).

Udhane S.S., Pandey A.V., Hofer G., Mullis P.E, & Flück C.E. (2015). Retinoic acid receptor beta and angiopoietin-like protein 1 are involved in the regulation of human androgen biosynthesis. Scientific Reports, 5, 10132.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!