Log In Sign up
The largest database of trusted experimental protocols

Perfecta sybr green

Manufactured by Quanta Biosciences
Visit Supplier
Sourced in United States

PerfeCTa SYBR Green is a ready-to-use reaction mix for quantitative real-time PCR. It contains SYBR Green I dye, a thermostable DNA polymerase, buffer, and proprietary performance enhancers.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop, by Thermo Fisher Scientific (8 mentions) Qscript cdna supermix, by Quanta Biosciences (5 mentions) C1000 thermocycler, by Bio-Rad (5 mentions) Cfx96 instrument, by Bio-Rad (4 mentions) Superscript 3, by Thermo Fisher Scientific (4 mentions) Iq5 system, by Bio-Rad (3 mentions) Qscript cdna synthesis kit, by Quanta Biosciences (3 mentions) Viia 7 system, by Thermo Fisher Scientific (3 mentions) Rneasy micro kit, by Qiagen (2 mentions) Aim 5 serum free media, by Thermo Fisher Scientific (2 mentions) Qscript cdna supermix kit, by Quanta Biosciences (2 mentions) Rna isolation kit, by Qiagen (2 mentions) Cfx connect real time pcr system, by Bio-Rad (2 mentions) Gapdh, by Integrated DNA Technologies (2 mentions) Cfx96, by Bio-Rad (2 mentions) Iscript cdna supermix, by Bio-Rad (2 mentions) Nanodrop 2000 spectrophotometer, by Bio-Rad (2 mentions) Total rna purification kit, by Norgen Biotek (2 mentions) Rnaeasy micro kit, by Qiagen (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions)

Close spelling variants of this product

PerfeCTa SYBR Green FastMix (271 citations) PerfeCTa SYBR Green SuperMix (151 citations) PerfeCTa SYBR Green FastMix ROX (79 citations) SYBR Green (48 citations) PerfeCTa SYBR Green FastMix Low ROX (30 citations) PerfeCTa SYBR Green SuperMix for iQ (20 citations) PerfeCTa SYBR Green FastMix kit (12 citations) PerfeCTa SYBR Green FastMix for iQ (11 citations) PerfeCTa SYBR Green FastMix reagent (8 citations) PerfecTa SYBR green SuperMix with Low ROX (7 citations)

32 protocols using perfecta sybr green

1

RT-PCR Analysis of ABCB4 Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated using the Isol-RNA lysis procedure (5 Prime, Hamburg, Germany). 25 μg of breast, kidney, liver and lung RNA of normal human samples were obtained from Agilent Technologies (Waldbronn, Germany). RNA was DNase (Fermentas GmbH, St.Leon-Rot, Germany) digested and then reversely transcribed19 (link). RT-PCR was performed with primers: ABCB4RTF1: GCAGACGGTGGCCCTGGTTGG, ABCB4RTR1: TGGAAAACAGCACCGGCTCCTG, ACTFW: CCTTCCTTCCTGGGCATGGAGTC and ACTRV: CGGAGTACTTGCGCTCAGGAGGA. For mouse mABCB4RTF1: CCCTCCAGCCGGCTTTCTCCA, mABCB4RTR1: GGACCGGAGCCTTGTGGTGAGG, mGAPDHRTF1: GCCGCCTGGAGAAACCTGCC and mGAPDHRTF1: CCCCGGCATCGAAGGTGGAA were utilized. Quantitative PCR (qRT-PCR) was performed in triplicates with PerfeCTa SYBR® Green (Quanta BioSciences, Gaithersburg, USA) using Rotor-Gene 3000 (Corbett Research, Qiagen, Hilden, Germany).
Kiehl S., Herkt S.C., Richter A.M., Fuhrmann L., El-Nikhely N., Seeger W., Savai R, & Dammann R.H. (2014). ABCB4 is frequently epigenetically silenced in human cancers and inhibits tumor growth. Scientific Reports, 4, 6899.
+ Open protocol
+ Expand
2

Differential Gene Expression in DRN

Check if the same lab product or an alternative is used in the 5 most similar protocols
One day after the last RI test, brains were rapidly removed after cervical dislocation and then sliced to 1mm thick coronal sections using a mouse brain slicer matrix (Alto Stainless Steel Coronal 1.00mm Brain Matrix, CellPoint Scientific) on ice. The DRN was removed using a 2-mm punch biopsy tool (Harris Uni-Core-2.00, Electron Microscopy Sciences) in ice-cold PBS. Samples were collected into 1.5 mL tubes, immediately frozen on dry ice, and stored at −80 °C until cDNA synthesis. For RNA extraction and cDNA synthesis, DRN samples were homogenized in TRIzol Reagent (Invitrogen) and then chloroform was added to isolate RNA. The RNA layer was processed with RNeasy Micro Kit (Qiagen) to extract total RNA and the total RNA concentration was measured using Nanodrop (Thermo Fisher Scientific). cDNA was synthesized from 500 ng of total RNA by reverse transcription using qSCRIPT cDNA SuperMix (Quanta Biosciences). Quantitative PCR reaction was conducted with Perfecta SYBR Green (Quanta Biosciences). Analysis was done using the ΔΔ Ct method and samples were normalized to Gapdh.
Takahashi A., Aleyasin H., Stavarache M.A., Li L., Cathomas F., Parise L., Lin H.Y., Burnett C., Flanigan M.E., Brancato A., Menard C., Pfau M.L., Kana V., Wang J., Hodes G.E., Sasaki T., Kaplitt M.G., Ogawa S., McEwen B.S, & Russo S.J. (2021). Neuromodulatory effect of interleukin 1β in the dorsal raphe nucleus on individual differences in aggression. Molecular psychiatry, 27(5), 2563-2579.
+ Open protocol
+ Expand
3

TGF-β1 Expression in Activated CD4 T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Differentiated CD4 T cells were restimulated with anti-CD3 (2 µg/ml) for an additional 24h in AIM V serum free media (Life Technologies). Culture supernatants were collected and TGFβ1 protein was estimated by ELISA (R&D Systems). Cells were used to extract total RNA using RNA isolation kit (Qiagen). Total RNA was reverse transcribed to cDNA with a qScript™ cDNA Supermix kit (Quanta Biosciences). Real time PCR was performed using PerfeCTa™ SYBR Green (Quanta Biosciences) on a CFX Connect Real-time PCR system (Bio-Rad). The following primer sequences were used: TGFβ1 (F: TGACGTCACTGGAGTTGTACGG, R: GGTTCATGTCATGGATGGTGC); GAPDH (F: CATGGCCTTCCGTGTTCCTA, R: CCTGCTTCACCACCTTCTTGAT) (Integrated DNA Technologies).
Gupta P.K., Wagner S.R., Wu Q, & Shilling R.A. (2016). Th17 cells are not required for maintenance of IL-17A producing γδ T cells in vivo. Immunology and cell biology, 95(3), 280-286.
+ Open protocol
+ Expand
4

qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using the RNeasy isolation kit (Qiagen, Valencia, CA) and reverse-transcribed into cDNA using the qScript Supermix from Quanta Biosciences (Gaitherburg, MD). cDNA was diluted 1:10 in RNase-free water and stored at −20°C until use. qPCR was performed on a 7300 real-time PCR system (Applied Biosystems, Foster City, CA) using 1 μl cDNA, PerfeCTa SYBR green (Quanta Biosciences, Gaitherburg, MD) and individual primers (Table 1) in a final concentration of 5 μM. Samples were run in duplicate and the relative gene expression was determined with the comparative cycle threshold (Ct) method and expressed as 2−Ct(target gene)-Ct(GAPDH).
Wedel J., Stack M.P., Seto T., Sheehan M.M., Flynn E.A., Stillman I.E., Kong S.W., Liu K, & Briscoe D.M. (2019). T CELL SPECIFIC ADAPTOR PROTEIN REGULATES MITOCHONDRIAL FUNCTION AND CD4+ T REGULATORY CELL ACTIVITY IN VIVO FOLLOWING TRANSPLANTATION. Journal of immunology (Baltimore, Md. : 1950), 203(8), 2328-2338.
+ Open protocol
+ Expand
5

Quantitative RNA Expression Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated using the Isol-RNA lysis procedure (5 Prime, Hamburg, Germany). 25 μg of breast, kidney, liver and lung RNA of normal human samples (pools of five, one, three and four, respectively) were obtained from Agilent Technologies (Waldbronn, Germany). RNA was DNase (Fermentas GmbH, St.Leon-Rot, Germany) digested and then reversely transcribed [44 (link)]. RT-PCR was performed with primers: AATKRTF1: TGGCCTGGCTCACTGCAAGTACAG, AATKRTR1: CCCAGATGGTCACGCCCAGG, mAatkRTF1: GTGCTGAAGTGACCCCCTAC, mAatkRTR1: GGTCAGCGGTCACGAGATAG, ßACTFW: CCTTCCTTCCTGGGCATGGAGTC, ßACTRW: CGGAGTACTTGCGCTCAGGAGGA, GGCTCFRTFW: CAGGAAACGGAGGCTACGGTGG, GGCTCFRTRW: CCTCCTGCAGGCCTCCTTTGGA. Quantitative PCR (qRT-PCR) was performed in triplicate with PerfeCTa SYBR® Green (Quanta BioSciences, Gaithersburg, USA) using a Rotor-Gene 3000 (Corbett Research, Qiagen, Hilden, Germany).
Haag T., Herkt C.E., Walesch S.K., Richter A.M, & Dammann R.H. (2014). The apoptosis associated tyrosine kinase gene is frequently hypermethylated in human cancer and is regulated by epigenetic mechanisms. Genes & Cancer, 5(9-10), 365-374.
+ Open protocol
+ Expand
6

Quantitative RT-PCR Analysis of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the Norgen Total RNA isolation kit and quantified using a NanoDrop Spectrophotometer ND-1000. Complementary DNA was synthesized from 0.5 to 1 μg RNA using the qScript cDNA Super Mix (Quanta Biosciences) and a C1000 Thermo Cycler (Bio-Rad) with the following cycle parameters: 4 min at 25 °C, 30 min at 42 °C, 5 min at 85 °C, hold at 4 °C. qRT-PCR was performed using the Perfecta SybrGreen (Quanta Biosciences) and CFX96 instrument (Bio-Rad). CFX Manager 3.0 software was used for quantification of gene expression and levels were normalized to GAPDH expression with secondary validation normalized to Actin expression. Primers include: Actin (F: 5′-TATCCCTGTACGCCTCT-3′; R: 5′-AGGTCTTTGCGGATGT-3′), Axin2 (F: 5′-TGGAGCCGGCTGCGCTTTGAT-3′; R: 5′-CTGGGGTCCGGGAGGCAAGTC-3′), Bmi1 (F: 5′-GGAGGAGGTGAATGATAAAAGAT-3′; R: 5′-AGGTTCCTCCTCATACATGACA-3′), GAPDH (F: 5′-TGCACCACCAACTGCTTAGC-3′; R: 5′-GGCATGGACTGTGGTCATGAG-3′), Sox2 (F: 5′-TCAGGAGTTGTCAAGGCAGAGAAG-3′; R: 5′-GCCGCCGCCGATGATTGTTATTAT-3′).
Manoranjan B., Venugopal C., Bakhshinyan D., Adile A.A., Richards L., Kameda-Smith M.M., Whitley O., Dvorkin-Gheva A., Subapanditha M., Savage N., Tatari N., McKenna D., Bassey-Archibong B., Winegarden N., Hallett R., Provias J.P., Yarascavitch B., Ajani O., Fleming A., Bader G.D., Pugh T.J., Doble B.W, & Singh S.K. (2020). Wnt activation as a therapeutic strategy in medulloblastoma. Nature Communications, 11, 4323.
+ Open protocol
+ Expand
7

TGF-β1 Expression in Activated CD4 T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Differentiated CD4 T cells were restimulated with anti-CD3 (2 µg/ml) for an additional 24h in AIM V serum free media (Life Technologies). Culture supernatants were collected and TGFβ1 protein was estimated by ELISA (R&D Systems). Cells were used to extract total RNA using RNA isolation kit (Qiagen). Total RNA was reverse transcribed to cDNA with a qScript™ cDNA Supermix kit (Quanta Biosciences). Real time PCR was performed using PerfeCTa™ SYBR Green (Quanta Biosciences) on a CFX Connect Real-time PCR system (Bio-Rad). The following primer sequences were used: TGFβ1 (F: TGACGTCACTGGAGTTGTACGG, R: GGTTCATGTCATGGATGGTGC); GAPDH (F: CATGGCCTTCCGTGTTCCTA, R: CCTGCTTCACCACCTTCTTGAT) (Integrated DNA Technologies).
Gupta P.K., Wagner S.R., Wu Q, & Shilling R.A. (2016). Th17 cells are not required for maintenance of IL-17A producing γδ T cells in vivo. Immunology and cell biology, 95(3), 280-286.
+ Open protocol
+ Expand
8

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using the RNeasy Mini Kit (QIAGEN, Hilden, Germany, http://www.qiagen.com/) and used to synthesize complementary DNA with qScript cDNA SuperMix (Quanta BioSciences, MD, USA, http://www.quantabio.com/page/contact.php). Quantitative real-time PCR (qPCR) assays were carried out in LightCycler LC480 (Roche) or CFX96 (Bio-Rad, Birmingham, United Kingdom, http://www.bio-rad.com/?WT.srch=1&WT.mc_id=aw-corp-eu-brand&WT.knsh_id=628e3f91-bdaa-d6e8-22d6-0000734b512f) thermocyclers using SsoFast EvaGreen Supermix (Bio-Rad) or PerfeCTa SYBR Green (Quanta BioSciences) with primers listed in Supporting Information Table S1. The primer set designated Cited2#1 (Supporting Information Table S1) was used to detect both mouse endogenous Cited2 and human exogenous flag-CITED2 cDNA in qPCR experiments, except when otherwise stated. The primer set designated Cited2#2 is specific for detection of endogenous mouse Cited2 expression. Expression levels were normalized to Gapdh or Tbp. Quantitative analyses were performed independently at least three times and are shown with standard error of the mean.
Kranc K.R., Oliveira D.V., Armesilla-Diaz A., Pacheco-Leyva I., Catarina Matias A., Luisa Escapa A., Subramani C., Wheadon H., Trindade M., Nichols J., Kaji K., Enver T, & Bragança J. (2014). Acute Loss of Cited2 Impairs Nanog Expression and Decreases Self-Renewal of Mouse Embryonic Stem Cells. Stem Cells (Dayton, Ohio), 33(3), 699-712.
+ Open protocol
+ Expand
9

Quantitative Analysis of ITGA5 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from 2.5 × 105 cells with Total RNA Purification Kit (Norgen, Cat#37500), with modified elution volume of 27µL. RNA concentration was determined using NanoDrop 2000 Spectrophotometer and 1000µg of RNA was used to synthesize complementary DNA (cDNA) using iScript cDNA SuperMix (Bio-Rad, Cat#1708841) and a C1000 Thermo Cycler (Bio-Rad) according to the manufacturer’s guidelines. RT-qPCR analysis was performed with PerfeCTa SybrGreen (Quanta Biosciences, Cat#95054-100) and CFX96 instrument (Bio-Rad). Quantification of gene expression was performed by using CFX manager 3.0 software, with GAPDH as housekeeping gene. The following qPCR primers were used to measure mRNA levels of ITGA5 (FWD 5’-ACCTCTGATGCCTGAGTCCT-3’, REV 5’-AGAAGTACCCAGACCCCTCC-3’ and GAPDH (FWD 5’-TGAACCACCAACTGCTTAGC − 3’, REV 5’-GGCATGGACTGTGGTCATGAG-3’).
Bakhshinyan D., Suk Y., Kuhlmann L., Adile A.A., Ignatchenko V., Custers S., Gwynne W.D., Macklin A., Venugopal C., Kislinger T, & Singh S.K. (2023). Dynamic profiling of medulloblastoma surfaceome. Acta Neuropathologica Communications, 11, 111.
+ Open protocol
+ Expand
10

RT-qPCR Analysis of Mouse Brain Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from mouse brain tissue was extracted using the Ambion RNAqueous-Micro total RNA isolation kit (Life Technologies Corp.). RNA purity, integrity (RIN > 7) and concentration was determined, and 100 ng of total RNA was then used to synthesize cDNA using SuperScript III (Invitrogen). RT-qPCR was performed on a ViiA7 System (Applied Biosystems) using PerfeCTa SYBR Green (Quanta Biosciences, Gaithersburg, USA). Forward/Reverse primers were designed for different exons, and the RNA was treated with DNase H to avoid false-positives. Amplicon specificity was verified by melting curve analysis. All RT-qPCR reactions were conducted in technical triplicates and the results were averaged for each sample, normalized to Actb levels and the relevant reporter genes such as RFP, GFP and T7 for the viruses, and analyzed using the comparative ΔΔCt method (Livak and Schmittgen, 2001 (link)). The primers (Mus musculus) that were used are listed in Table S3.
Panayotis N., Sheinin A., Dagan S.Y., Tsoory M.M., Rother F., Vadhvani M., Meshcheriakova A., Koley S., Marvaldi L., Song D.A., Reuveny E., Eickholt B.J., Hartmann E., Bader M., Michaelevski I, & Fainzilber M. (2018). Importin α5 Regulates Anxiety through MeCP2 and Sphingosine Kinase 1. Cell Reports, 25(11), 3169-3179.e7.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!