Log In Sign up
The largest database of trusted experimental protocols

Prep cell apparatus

Manufactured by Bio-Rad
Visit Supplier

The Prep Cell apparatus is a laboratory equipment designed for protein purification. It utilizes a vertical polyacrylamide gel electrophoresis system to separate and elute proteins based on their molecular weight. The core function of the Prep Cell is to provide an efficient method for the purification of target proteins from complex mixtures.

Automatically generated - may contain errors

Lab products found in correlation

Pgem t easy vector, by Promega (2 mentions) Hiload 16 60 superdex 200, by GE Healthcare (2 mentions) Amicon ultra centrifugal filter unit, by Merck Group (1 mentions) Polyacrylamide gel, by Bio-Rad (1 mentions) Superdex 200 column, by GE Healthcare (1 mentions) Hinfi, by Takara Bio (1 mentions) Calf intestinal alkaline phosphatase, by Takara Bio (1 mentions) Ecorv, by Takara Bio (1 mentions) Hiload 16 60 superdex 200 column, by Cytiva (1 mentions) Nextseq 500, by Illumina (1 mentions) Sybr gold staining, by Thermo Fisher Scientific (1 mentions) T4 dna ligase, by Nippon Gene (1 mentions) Amicon ultra, by Merck Group (1 mentions) Zorbax 300sb c18, by Agilent Technologies (1 mentions) Mascot search engine, by Matrix Science (1 mentions) Trypsin, by Roche (1 mentions) Superdex 200 gel filtration column, by GE Healthcare (1 mentions) Monos chromatography, by GE Healthcare (1 mentions) Pd 10 column, by Cytiva (1 mentions) Hiload 16 60 superdex 200 size exclusion column, by GE Healthcare (1 mentions)

Spelling variants of this product

Prep Cell (12 citations) Model 491 Prep Cell apparatus (4 citations)

27 protocols using prep cell apparatus

1

Reconstitution of Nucleosomes from Plasmid DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
601 DNA containing the Nr5a2 motif at SHL +5.5 was purified with a large-scale plasmid purification using a plasmid containing 16 copies cloned into pGEM-T easy vector (Promega). The endogenous DNA fragments for nucleosome reconstitution were amplified by PCR and further purified by polyacrylamide gel (6%) electrophoresis using a Prep Cell apparatus (Bio-Rad). The eluted DNA was concentrated with an Amicon Ultra centrifugal filter unit (Millipore). The DNA sequences are shown in Supplementary Table 2.
The nucleosomes were reconstituted using a salt dialysis method39 (link). For the nucleosome reconstitution with 601 DNA, the DNA and mouse histone octamer were mixed in a 1:1.8–2.0 molar ratio in 2 M KCl. For the nucleosome reconstitution with the endogenous DNA sequence, the DNA, non-labeled or Alexa-Fluor-647-labeled H2A–H2B complex, and H3.3–H4 complex were mixed in a 1:4:3.6 molar ratio in 2 M KCl high-salt buffer. The reconstituted nucleosomes were further purified by polyacrylamide gel (6%) electrophoresis using a Prep Cell apparatus (Bio-Rad). The nucleosomes were concentrated with an Amicon Ultra centrifugal filter unit (Millipore) and were stored in TCS buffer (20 mM Tris-HCl (pH 7.5) and 1 mM DTT) at 4 °C.
Kobayashi W., Sappler A.H., Bollschweiler D., Kümmecke M., Basquin J., Arslantas E.N., Ruangroengkulrith S., Hornberger R., Duderstadt K, & Tachibana K. (2024). Nucleosome-bound NR5A2 structure reveals pioneer factor mechanism by DNA minor groove anchor competition. Nature Structural & Molecular Biology, 31(5), 757-766.
+ Open protocol
+ Expand
2

Nucleosome Reconstitution and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The DNA and histone octamer complex were mixed in a 1:1.5 molar ratio in the presence of 2 M KCl. The samples were dialysed against refolding buffer (RB) high (10 mM Tris-HCl pH 7.5, 2 M KCl, 1 mM EDTA, and 1 mM DTT). The KCl concentration was gradually reduced from 2 M to 0.25 M using a peristaltic pump with RB low (10 mM Tris-HCl (pH 7.5), 250 mM KCl, 1 mM EDTA, and 1 mM DTT) at 4°C. Samples were further dialysed against RB low buffer at 4°C overnight. Reconstituted nucleosomes were incubated at 55°C for 2 h followed by purification on native polyacrylamide gel electrophoresis using a Prep Cell apparatus (Bio-Rad) in TCS buffer (10 mM Tris-HCl (pH 7.5) and 250 μM TCEP) to remove non-specific complexes formed between free DNA and histones.
Matsumoto S., Cavadini S., Bunker R.D., Grand R.S., Potenza A., Rabl J., Yamamoto J., Schenk A.D., Schübeler D., Iwai S., Sugasawa K., Kurumizaka H, & Thomä N.H. (2019). DNA damage detection in nucleosomes involves DNA register shifting. Nature, 571(7763), 79-84.
+ Open protocol
+ Expand
3

Reconstitution of Histones H2Bub120 and H4ub31 Nucleosomes

Check if the same lab product or an alternative is used in the 5 most similar protocols
To reconstitute the nucleosomes containing histones H2Bub120 and/or H4ub31, histones H3 C110A, H4ub31 or (H4), H2A and H2Bub120 (or H2B) were mixed in 20 mM Tris-HCl buffer (pH 7.5), containing 1 mM EDTA and 7 M guanidine hydrochloride. The samples were dialysed against 20 mM Tris-HCl buffer (pH 7.5) containing 2 M NaCl and the resulting histone octamers were further purified by gel filtration chromatography on HiLoad 16/60 Superdex 200 (GE Healthcare). Nucleosomes containing H2Bub120 and/or H4ub31 were reconstituted with the palindromic 146 base-pair satellite DNA fragment by the salt dialysis method, as described previously [40 ]. The DNA fragments were mixed with histone octamers in 10 mM Tris-HCl buffer (pH 7.5), containing 2 M KCl and 1 mM EDTA. The KCl concentration was gradually decreased to 250 mM, using a peristaltic pump. Reconstituted nucleosomes were further purified by non-denaturing 6% acrylamide gel electrophoresis, using a Prep cell apparatus (Bio-Rad).
Machida S., Sekine S., Nishiyama Y., Horikoshi N, & Kurumizaka H. (2016). Structural and biochemical analyses of monoubiquitinated human histones H2B and H4. Open Biology, 6(6), 160090.
+ Open protocol
+ Expand
4

Nucleosome Core Particle Reconstitution

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
NCPs were assembled essentially as described15 (link),56 (link). Briefly Human H2A, H2A K119C, H2B, H3.3, H3.1 C96SC110A and H4 were over-expressed in E.coli and purified from inclusion bodies. Histones were refolded from denaturing buffer through dialysis against 10 mM Tris-HCl pH 7.5, 2 M NaCl, 5 mM beta-mercaptoethanol, 1 mM EDTA buffer, and octamers were purified by size exclusion chromatography over a Superdex-200 column (GE Healthcare). DNA fragments for wrapping NCPs (171-bp Widom 601 DNA, 145-bp D02 DNA or D02 DNA appended with biotin and fluorophores) were generated by PCR using Pfu polymerase and HPLC-grade oligonucleotides (IDT). PCR products generated in 96-well plates (384 × 100 μl) were pooled, filtered and purified on a ResorceQ column as described15 (link). NCPs were assembled by salt dialysis as described15 (link),30 (link),56 (link) and heat repositioned at 37 °C for 30 min. D02 containing NCPs were further purified using a PrepCell apparatus with a 5% polyacrylamide gel (BioRad).
Wilson M.D., Renault L., Maskell D.P., Ghoneim M., Pye V.E., Nans A., Rueda D.S., Cherepanov P, & Costa A. (2019). Retroviral integration into nucleosomes through DNA looping and sliding along the histone octamer. Nature Communications, 10, 4189.
+ Open protocol
+ Expand
5

Preparation of Widom 601L DNA

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The 145 bp 601 DNA was prepared as previously described (24 (link),25 ). The palindromic derivative of the Widom 601 DNA, the 193 bp Widom 601L DNA, was generated and prepared as described (26 (link),27 (link)). In brief, multiple repeats of each half of the 601L DNA were generated in the pGEM-T Easy vector. Each half of the 601L DNA was excised from the vector by digestion with EcoRV (Takara), followed by PEG precipitation to separate the vector DNA and the DNA fragment. The resulting DNA fragments were dephosphorylated by Calf Intestinal Alkaline Phosphatase (Takara), extracted by phenol–chloroform extraction, and precipitated with ethanol. DNA fragments were cleaved by HinfI (Takara) and purified through TSK-DEAE ion exchange chromatography. The purified DNA fragments were ligated, and unligated fragments were separated using a Prep Cell apparatus (Bio-Rad). The 193 bp Widom 601L DNA sequence is as follows: ATCACGTAATATTGGCCAGCTAGGATCACAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGGAATCCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTGTGATCCTAGCTGGCCAATATTACGTGAT.
Oishi T., Hatazawa S., Kujirai T., Kato J., Kobayashi Y., Ogasawara M., Akatsu M., Ehara H., Sekine S.I., Hayashi G., Takizawa Y, & Kurumizaka H. (2023). Contributions of histone tail clipping and acetylation in nucleosome transcription by RNA polymerase II. Nucleic Acids Research, 51(19), 10364-10374.
+ Open protocol
+ Expand
6

Nucleosome Reconstitution and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The DNA and histone octamer complex were mixed in a 1:1.5 molar ratio in the presence of 2 M KCl. The samples were dialysed against refolding buffer (RB) high (10 mM Tris-HCl pH 7.5, 2 M KCl, 1 mM EDTA, and 1 mM DTT). The KCl concentration was gradually reduced from 2 M to 0.25 M using a peristaltic pump with RB low (10 mM Tris-HCl (pH 7.5), 250 mM KCl, 1 mM EDTA, and 1 mM DTT) at 4°C. Samples were further dialysed against RB low buffer at 4°C overnight. Reconstituted nucleosomes were incubated at 55°C for 2 h followed by purification on native polyacrylamide gel electrophoresis using a Prep Cell apparatus (Bio-Rad) in TCS buffer (10 mM Tris-HCl (pH 7.5) and 250 μM TCEP) to remove non-specific complexes formed between free DNA and histones.
Matsumoto S., Cavadini S., Bunker R.D., Grand R.S., Potenza A., Rabl J., Yamamoto J., Schenk A.D., Schübeler D., Iwai S., Sugasawa K., Kurumizaka H, & Thomä N.H. (2019). DNA damage detection in nucleosomes involves DNA register shifting. Nature, 571(7763), 79-84.
+ Open protocol
+ Expand
7

Reconstitution of Nucleosomes with Widom 601 DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
The nucleosomes with the 153-base-pair (with a three-base 3′ ssDNA overhang) and 158-base-pair (with blunt ends) Widom 601 DNA were prepared as previously described38 (link),39 (link). In brief, the histone octamer was reconstituted with histones H2A, H2B, H3.1 and H4, and the resulting histone complex was purified by gel filtration chromatography on a HiLoad16/60 Superdex 200 column (Cytiva). The 158-base-pair Widom 601 DNA fragment with blunt ends was amplified by PCR and purified by native polyacrylamide gel electrophoresis, using a Prep Cell apparatus (Bio-Rad). The sequence of the 158-base-pair DNA fragment is as follows: 5′-CGTGGTGGCCGTTTTCGTTGTTTTTTTCTGTCTCGTGCCTGGTGTCTTGGGTGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTGAT-3′. Nucleosomes were reconstituted by the salt dialysis method and subsequently purified with a Prep Cell apparatus38 (link).
Shioi T., Hatazawa S., Oya E., Hosoya N., Kobayashi W., Ogasawara M., Kobayashi T., Takizawa Y, & Kurumizaka H. (2024). Cryo-EM structures of RAD51 assembled on nucleosomes containing a DSB site. Nature, 628(8006), 212-220.
+ Open protocol
+ Expand
8

High-throughput Nucleosome Positioning Assay for Nr5a2 Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
SeEN-seq was performed as previously described10 (link),19 (link). Nr5a2 motif (JASPAR ID: MA0505.1, TCAAGGCCA) was tiled at 1-bp intervals across the 147-bp Widom 601 DNA sequence. The pooled DNA library (153 bp) was digested by EcoRV and was further purified using a gel-extraction kit. For preparation of the nucleosome library, purified library DNA (3 μg) was mixed with 97 µg spike-in 601 DNA (153 bp). The nucleosome library was reconstituted using a salt dialysis method and was further purified by polyacrylamide gel (6%) electrophoresis using a Prep Cell apparatus (Bio-Rad). The nucleosomes (0.1 μΜ) were incubated with mouse Nr5a2 (0, 1 or 1.2 μΜ) or human NR5A2 (0, 0.4 or 0.8 μΜ) at room temperature for 30 min in a reaction buffer (20 mM Tris-HCl (pH 7.5), 120 mM NaCl, 1 mM MgCl2, 10 μΜ ZnCl2, 1 mM DTT, 100 μg ml–1 BSA). Three independent experiments were performed, and the bands were visualized by SYBR Gold staining (Invitrogen). DNA libraries were prepared as described previously. Purified DNA libraries were sequenced on a NextSeq 500 with paired-end 150-bp reads (Illumina). The DNA sequences are shown in Supplementary Table 1.
Kobayashi W., Sappler A.H., Bollschweiler D., Kümmecke M., Basquin J., Arslantas E.N., Ruangroengkulrith S., Hornberger R., Duderstadt K, & Tachibana K. (2024). Nucleosome-bound NR5A2 structure reveals pioneer factor mechanism by DNA minor groove anchor competition. Nature Structural & Molecular Biology, 31(5), 757-766.
+ Open protocol
+ Expand
9

Reconstitution of Nucleosomes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The histone octamer was reconstituted as described previously (33 (link)). The nucleosome was reconstituted with purified histone octamer and the 193 base-pair (35 (link)) DNA fragment containing Widom 601 sequence (36 (link)) by the salt dialysis method, as described previously (33 (link)). The reconstituted nucleosomes were further purified by polyacrylamide gel electrophoresis, using Prep Cell apparatus (Bio-Rad).
Osakabe A., Lorković Z.J., Kobayashi W., Tachiwana H., Yelagandula R., Kurumizaka H, & Berger F. (2018). Histone H2A variants confer specific properties to nucleosomes and impact on chromatin accessibility. Nucleic Acids Research, 46(15), 7675-7685.
+ Open protocol
+ Expand
10

Reconstitution of Sat2 Nucleosomes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nucleosomes containing the Sat2 DNA fragments were reconstituted by the salt dialysis method, as described previously [37 –39 (link)]. DNA fragments were mixed with histone octamers in the presence of 2 M KCl. The KCl concentration was gradually reduced from 2 M to 0.25 M, using a peristaltic pump. The reconstituted nucleosomes were incubated at 55°C for 2 h and were further purified by non-denaturing PAGE, using a Prep Cell apparatus (Bio-Rad).
Osakabe A., Adachi F., Arimura Y., Maehara K., Ohkawa Y, & Kurumizaka H. (2015). Influence of DNA methylation on positioning and DNA flexibility of nucleosomes with pericentric satellite DNA. Open Biology, 5(10), 150128.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!