Pcr primers

RT-qPCR was used to evaluate the expression levels of the key apoptotic genes, BCL2 and BAX, and AP-1 downstream gene ETS1. After phosphate-buffered saline (PBS) or veratramine treatment for 48 h, HepG2 cells were subjected to total RNA isolation using TRIzol^® reagent. Subsequently, cDNA was synthesized using the HiScript III 1st Strand cDNA Synthesis kit and qPCR was performed using the ChamQ SYBR qPCR Master Mix according to the manufacturer's instructions. Thermocycling parameters were optimized as 5 min at 95°C, followed by 40 cycles at 95°C (15 sec), 60°C (30 sec); melt curve: 95°C (15 sec), 60°C (30 sec) and 95°C (15 sec). PCR primers were provided by Guangzhou RiboBio Co., Ltd., and β-actin was used as the internal reference. Quantitative analysis of relative mRNA expression levels was performed according to the 2^−ΔΔCq method (36 (link)). Primer sequences were as follows: BCL2 forward, 5′GTGGAGGAGCTCTTCAGGGA3′ and reverse, 5′AGGCACCCAGGGTGATGCAA3′); BAX forward, 5′GGCCCACCAGCTCTGAGCAGA3′ and reverse, 5′GCCACGTGGGCGTCCCAAAGT3′; ETS1 forward, 5′GCGCGCTAGCAACTTGCTACCATCCCGT3′ and reverse, 5′GCGCAAGCTTTGCCATCACTCGTCGGC3′; β-actin forward, 5′ACAAAGTGGTCATTGAGGGC3′and reverse, 5′GCCGTCAGGCAGCTCGTAGC3′.

Total RNA was extracted from the cultured cells using Trizol reagent (Life Technologies, USA) according to the manufacturer’s protocol. For miR-183 expression level detection, total RNA was reverse-transcribed with a miR-183-specific RT primer (RiboBio, China) and amplified with PCR primers (RiboBio, China) on the ABI 7300 Real-Time PCR System (Life Technologies, USA). The relative expression of miR-183 was normalized against U6. Real-time RT-PCR for PDCD4 was performed with primers specific for PDCD4 (forward, 5′-TATGATGTGGAGGAGGTGGATGTGA-3′; and reverse, 5′-CCTTTCATCCAAAGGCAAAACTACAC-3′) (Frankel et al., 2008 (link)), and the relative expression level was normalized against β-actin (forward, 5′-ATCCGCAAAGACCTGT-3′; and reverse, 5′-GGGTGTAACACTAAG-3′), which was designed by Invitrogen (Life Technologies, USA). The difference between miR-183 and PDCD4 expressions in cells treated with mimic/inhibitor and each NC was calculated using the 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)), where ΔCt = (Ct_{miR-183/PDCD4} - Ct_u6/β-actin) and ΔΔCt = ΔCt_{mimic/ihibitor} -ΔCt_NC.

The total RNAs were extracted by Trizol (Invitrogen Inc., Carlsbad, CA, USA), and the RNA concentration and purity were evaluated. As to miR-576-5p and U6, the PCR primers and Stem-loop specific reversely transcribed primers were acquired from Guangzhou RiboBio Co., Ltd. (Guangdong, China). Primer sequences were not provided here due to business factors. Random primers with MMLV reverse transcriptase (Invitrogen) were selected for the reverse transcription of ANXA2, Bcl-2 and Bax by glyceraldehyde phosphate dehydrogenase (GAPDH). The PCR primers were synthesized by Invitrogen. PCR reaction was performed using a SYBR Green PCR Master Mix (BioTeke Co., Ltd., Beijing, China) with U6 and GAPDH as the internal reference. The data were analyzed using the 2^−ΔΔCt method [22 (link)].