Log In Sign up
The largest database of trusted experimental protocols

Wizard plus sv miniprep

Manufactured by Promega
Visit Supplier
Sourced in United States

The Wizard Plus SV Minipreps is a DNA purification system designed for the rapid and efficient isolation of plasmid DNA from bacterial cultures. It utilizes a silica-based membrane technology to capture and purify DNA, providing a simple and reliable method for DNA extraction.

Automatically generated - may contain errors

Lab products found in correlation

Wizard sv gel and pcr clean up system, by Promega (4 mentions) Zymoprep yeast plasmid miniprep 2 kit, by Zymo Research (3 mentions) Miseq reagent kit v3, by Illumina (3 mentions) Neb5α strain of e coli, by New England Biolabs (2 mentions) Q5 high fidelity pcr, by New England Biolabs (2 mentions) Pgem t easy vector system, by Promega (2 mentions) Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (2 mentions) Wizard sv gel kit, by Promega (1 mentions) Dyenamic et dye terminator kit, by GE Healthcare (1 mentions) Pgem t easy vector, by Promega (1 mentions) Pcr select cdna subtraction kit, by Takara Bio (1 mentions) Pcr clean up system, by Promega (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Restriction enzyme, by New England Biolabs (1 mentions) Ligation mix, by Takara Bio (1 mentions) Pcr4 topo ta, by Thermo Fisher Scientific (1 mentions) Qiaquick pcr purification kit, by Qiagen (1 mentions) Restriction enzyme, by Thermo Fisher Scientific (1 mentions) T4 dna ligase, by Promega (1 mentions) Q5 polymerase, by New England Biolabs (1 mentions)

Spelling variants of this product

Wizard Plus SV Minipreps DNA Purification System (149 citations) Wizard Plus SV Minipreps DNA Purification kit (14 citations) Wizard Plus SV Minipreps DNA Purification System Kit (10 citations) Wizard Plus SV Minipreps kit (5 citations) Wizard Plus SV Minipreps DNA Purification (4 citations) Wizard minipreps (2 citations) Minipreps (2 citations) Wizard Plus SV Minipreps DNA Purification Systems kit (2 citations)

18 protocols using wizard plus sv miniprep

1

Sequencing Yeast-Derived scFv Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
scFv encoding plasmids were recovered from yeast cultures by yeast miniprep with the Zymoprep yeast plasmid miniprep II kit (Zymo Research). Isolated DNA was transformed into NEB5α strain of E. coli (New England Biolabs) and the DNA of individual bacterial colonies was isolated (Wizard Plus SV Minipreps, Promega) and analyzed by Sanger sequencing to confirm the validity of the FACS selections. To prepare plasmids for Next Generation Sequencing, the scFv containing region from isolated plasmids was amplified by PCR using Q5 high fidelity PCR (NEB). Illumina NGS samples were prepped and run using the Illumina MiSeq v3 reagent kit following manufacturer’s protocols pooling four library samples per lane. Illumina sequencing returned an average of 14.3 million reads per sample, of which an average of 13.1 million mapped to the scFv amplicon.
PacBio long read NGS was completed by Genewiz pooling 3–4 library samples per SMRT cell. Sequencing results by PacBio returned 35–47k reads per sample sequenced, of which 15–26k aligned to the scFv amplicon. Sequencing data was processed using Geneious Prime and programs developed in-house to compute the amino acid frequency and distribution.
Swanson O., Rhodes B., Wang A., Xia S.M., Parks R., Chen H., Sanzone A., Cooper M., Louder M.K., Lin B.C., Doria-Rose N.A., Bonsignori M., Saunders K.O., Wiehe K., Haynes B.F, & Azoitei M.L. (2021). Rapid selection of HIV envelopes that bind to neutralizing antibody B cell lineage members with functional improbable mutations. Cell reports, 36(7), 109561.
+ Open protocol
+ Expand
2

Cloning and Sequencing of TaHKT2;1 cDNA

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-PCR amplicons were separated and excised from 1% agarose gels, purified using Wizard® SV Gel and PCR Clean-Up System (Promega, CA,USA), and cloned into pGEM®-T Easy Vector Systems (Promega, CA, USA). Three bacterial colonies containing cloned TaHKT2;1 FL-cDNA were selected and DNA templates were purified using Wizard® Plus SV Minipreps (Promega, CA, USA). The cloned fragments were sequenced using BigDye™ sequencing chemistry (Applied Biosystems, Perkin Elmer, Weiterstadt, Germany) and analysed using GENEIOUS 6.0.3 [51 (link)].
Ariyarathna H.C., Ul-Haq T., Colmer T.D, & Francki M.G. (2014). Characterization of the multigene family TaHKT 2;1 in bread wheat and the role of gene members in plant Na+ and K+ status. BMC Plant Biology, 14, 159.
+ Open protocol
+ Expand
3

Sequencing Yeast-Derived scFv Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
scFv encoding plasmids were recovered from yeast cultures by yeast miniprep with the Zymoprep yeast plasmid miniprep II kit (Zymo Research). Isolated DNA was transformed into NEB5α strain of E. coli (New England Biolabs) and the DNA of individual bacterial colonies was isolated (Wizard Plus SV Minipreps, Promega) and analyzed by Sanger sequencing to confirm the validity of the FACS selections. To prepare plasmids for Next Generation Sequencing, the scFv containing region from isolated plasmids was amplified by PCR using Q5 high fidelity PCR (NEB). Illumina NGS samples were prepped and run using the Illumina MiSeq v3 reagent kit following manufacturer’s protocols pooling four library samples per lane. Illumina sequencing returned an average of 14.3 million reads per sample, of which an average of 13.1 million mapped to the scFv amplicon.
PacBio long read NGS was completed by Genewiz pooling 3–4 library samples per SMRT cell. Sequencing results by PacBio returned 35–47k reads per sample sequenced, of which 15–26k aligned to the scFv amplicon. Sequencing data was processed using Geneious Prime and programs developed in-house to compute the amino acid frequency and distribution.
Swanson O., Rhodes B., Wang A., Xia S.M., Parks R., Chen H., Sanzone A., Cooper M., Louder M.K., Lin B.C., Doria-Rose N.A., Bonsignori M., Saunders K.O., Wiehe K., Haynes B.F, & Azoitei M.L. (2021). Rapid selection of HIV envelopes that bind to neutralizing antibody B cell lineage members with functional improbable mutations. Cell reports, 36(7), 109561.
+ Open protocol
+ Expand
4

cDNA Subtraction for Differential Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted with the use of the Trizol (Invitrogen) system following the manufacturer's instructions and RNA samples were submitted to Dnase to remove traces of DNA. The PCR-select cDNA subtraction kit (Clontech) was used in order to obtain differentially expressed transcripts [17 (link)] according to the manufacturer's instructions. Subtractions were carried out from EGG and 452 samples. Fragments of cDNA subtracted were extracted from gel, purified by Wizard SV gel kit and PCR clean-up system (Promega), and then cloned into pGEM-T easy vector (Promega) according to the manufacturer's instructions. Cloning was carried out using Escherichia coli bacteria DH5α (Life Technologies). Individual colonies were grown in 100 μL LB-ampicillin at 37°C, plasmid was isolated, and the presence of the insert was confirmed by digestion reaction using EcoRI (5 U) followed by a PCR using nested primers (Clontech). For those clones presenting insert, plasmidial DNA was isolated from bacterial cultures using Wizard plus SV minipreps (Promega) kit. Positive clones were sequenced in accordance with a method previously described [18 (link)], making use of DYEnamic ET dye terminator kit (MegaBACE, GE Healthcare).
Freitas M.A., Alvarenga Â.C., Fernandes H.C., Gil F.F., Melo M.N., Pesquero J.L, & Gomes M.A. (2014). Differentially Expressed Genes of Virulent and Nonvirulent Entamoeba histolytica Strains Identified by Suppression Subtractive Hybridization. BioMed Research International, 2014, 285607.
+ Open protocol
+ Expand
5

Plasmid DNA Purification and PCR Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
All plasmids used in this study are listed in Table 1 and the sequences of the primers used are listed in Table 2. PCR products and plasmid DNA were purified with kits Wizard SV Gel and PCR Clean-up System and Wizard Plus SV Minipreps, respectively (Promega). PCR fragments were amplified with Phusion High-fidelity DNA polymerase (Finnzymes). Restriction enzymes were from New England Biolabs.
Catalão M.J., Figueiredo J., Henriques M.X., Gomes J.P, & Filipe S.R. (2014). Optimization of Fluorescent Tools for Cell Biology Studies in Gram-Positive Bacteria. PLoS ONE, 9(12), e113796.
+ Open protocol
+ Expand
6

CRISPR Plasmid Generation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Supplementary Table 3 provides a list of sequence-verified plasmids used in this study. For plasmid gene editing, sgRNA oligonucleotides were annealed and cloned into pSpCas9(BB)-2A-Puro V2.0 plasmid (pX459v2, a gift from Feng Zhang, Addgene plasmid #62988) linearized with BbsI as described by Ran et al.51 (link). In brief, equal volumes of 100 µM oligos were annealed by heating to 95 °C for 5 min, followed by a slow cool down and a 1:200 dilution in water. 100 ng linearized vector were then mixed with 2 µL annealed oligo and 4 µL Ligation Mix (Takara) and incubated at 16 °C for 30 min. The mix was then transformed into competent bacteria using heat shock at 42 °C. Plasmid DNA from clones was extracted using the Wizard® Plus SV Minipreps (Promega) Kit according to the manufacturer’s instructions. Primers used for cloning are listed in Supplementary Table 4. Sequences were verified using the U6 primer ‘GAGGGCCTATTTCCCATGATTCC’ (dna790) and Sanger sequencing described below. Complete sequences are available upon request.
Grajcarek J., Monlong J., Nishinaka-Arai Y., Nakamura M., Nagai M., Matsuo S., Lougheed D., Sakurai H., Saito M.K., Bourque G, & Woltjen K. (2019). Genome-wide microhomologies enable precise template-free editing of biologically relevant deletion mutations. Nature Communications, 10, 4856.
+ Open protocol
+ Expand
7

Identification of Malaria Parasite Genetic Diversity

Check if the same lab product or an alternative is used in the 5 most similar protocols
The msp2 allelic repertoire was determined for a subset of samples from each site by amplifying genomic DNA using primer sets msp2F (5′- CTG CTT TAG GTA AGA TGA CTA AGR GTG ARG C- 3’) in combination with each of five reverse primer sets as previously described [9 (link)]. The amplicons were cloned into pCR4-TOPO-TA (Invitrogen) and plasmid DNA from 96 bacterial clones of each sample was extracted with Wizard plus SV minipreps (Promega). All inserts were sequenced in both directions as described above. The sequences were edited using BioEdit software and analyzed with HyPhy 2.0 [19 ].
Castañeda-Ortiz E.J., Ueti M.W., Camacho-Nuez M., Mosqueda J.J., Mousel M.R., Johnson W.C, & Palmer G.H. (2015). Association of Anaplasma marginale Strain Superinfection with Infection Prevalence within Tropical Regions. PLoS ONE, 10(3), e0120748.
+ Open protocol
+ Expand
8

Molecular Cloning Using Restriction Enzymes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Restriction enzymes (Fermentas) and T4 DNA ligase (Promega) were used as recommended by the supplier. Plasmid DNA were extracted from E. coli using Wizard Plus SV mini preps (Promega). PCR amplifications were performed using the MyTaq (Bioline) or Expand High Fidelity (Roche) systems. For fast colony screening, each colony was re-suspended in 25 μl PCR mix. PCR products were separated on 1% agarose gel using 1X TAE as running buffer and purified using QIAquick PCR purification kit (Qiagen). DNA sequences were determined with the ABI310 rhodamine termination reaction kit (ABI310 Genetic Analyzer, Applied Biosystems).
Israeli M., Elia U., Rotem S., Cohen H., Tidhar A., Bercovich-Kinori A., Cohen O, & Chitlaru T. (2019). Distinct Contribution of the HtrA Protease and PDZ Domains to Its Function in Stress Resilience and Virulence of Bacillus anthracis. Frontiers in Microbiology, 10, 255.
+ Open protocol
+ Expand
9

Yeast-Derived scFv Plasmid Isolation and Sequencing

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ScFv encoding plasmids were recovered from yeast cultures by miniprep with the Zymoprep yeast plasmid miniprep II kit (Zymo Research) as previously described [37 (link)]. Isolated DNA was transformed into NEB5α E. coli (NEB), and the DNA of individual bacterial colonies was isolated (Wizard Plus SV Minipreps, Promega) and analyzed by Sanger sequencing. To prepare for Next Generation Sequencing, the scFv insert from isolated plasmids was amplified by PCR using Q5 polymerase (NEB). DNA samples were prepped and run using the Illumina MiSeq v3 reagent kit following manufacturer’s protocols. Illumina sequencing returned an average of 21.6 million reads per sample, of which an average of 20.7 million mapped to the scFv amplicon. Sequencing data was processed using Geneious Prime and in-house scripts to compute the amino acid frequency and distribution.
Swanson O., Martin Beem J.S., Rhodes B., Wang A., Barr M., Chen H., Parks R., Saunders K.O., Haynes B.F., Wiehe K, & Azoitei M.L. (2023). Identification of CDRH3 loops in the B cell receptor repertoire that can be engaged by candidate immunogens. PLOS Pathogens, 19(5), e1011401.
+ Open protocol
+ Expand
10

Constructing Plasmid pTH1mp-crtMN

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmid DNA was isolated by the Wizard Plus SV Minipreps (Promega). For construction of vector pTH1mp-crtMN, plasmid pTHmp-lysC (Brautaset et al., 2010 (link)) was digested with Acc65I and PciI and used as backbone. A DNA fragment corresponding to the crtMN was PCR amplified from pHYcrtMN (Yoshida et al., 2009 (link)) using the following primers:
Forward primer (crtMN-R):
Reverse primer (crtMN-F):
The resulting PCR-product (2.4 kb) was end digested with Acc65I and PciI, and ligated into the backbone, resulting in the vector pTH1mp-crtMN (8.2 kb). The plasmid was verified by DNA sequencing.
Preparation of electrocompetent cells of B. methanolicus and transformation thereof was performed as previously described (Jakobsen et al., 2006 (link)). SOBsuc plates (1% (w/v) agar) supplemented with suitable antibiotics were used instead of regeneration plates, as described by Irla et al. (2016a) (link).
Hakvåg S., Nærdal I., Heggeset T.M., Kristiansen K.A., Aasen I.M, & Brautaset T. (2020). Production of Value-Added Chemicals by Bacillus methanolicus Strains Cultivated on Mannitol and Extracts of Seaweed Saccharina latissima at 50°C. Frontiers in Microbiology, 11, 680.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!